ID: 1185402768

View in Genome Browser
Species Human (GRCh38)
Location 22:50627241-50627263
Sequence CACCCCAAGGTGCCACTTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185402757_1185402768 12 Left 1185402757 22:50627206-50627228 CCCTGATGGGGGGGCAGGAAGGC 0: 1
1: 0
2: 0
3: 30
4: 285
Right 1185402768 22:50627241-50627263 CACCCCAAGGTGCCACTTGCCGG 0: 1
1: 0
2: 1
3: 7
4: 127
1185402758_1185402768 11 Left 1185402758 22:50627207-50627229 CCTGATGGGGGGGCAGGAAGGCC 0: 1
1: 1
2: 1
3: 19
4: 261
Right 1185402768 22:50627241-50627263 CACCCCAAGGTGCCACTTGCCGG 0: 1
1: 0
2: 1
3: 7
4: 127
1185402760_1185402768 -10 Left 1185402760 22:50627228-50627250 CCCCCTCAGGCCCCACCCCAAGG 0: 1
1: 0
2: 4
3: 94
4: 746
Right 1185402768 22:50627241-50627263 CACCCCAAGGTGCCACTTGCCGG 0: 1
1: 0
2: 1
3: 7
4: 127
1185402748_1185402768 30 Left 1185402748 22:50627188-50627210 CCTAGAAATCGATGGAAGCCCTG 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1185402768 22:50627241-50627263 CACCCCAAGGTGCCACTTGCCGG 0: 1
1: 0
2: 1
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185402768 Original CRISPR CACCCCAAGGTGCCACTTGC CGG Exonic
900999076 1:6138601-6138623 CAAACCCAGGTGCCACGTGCAGG - Intronic
901019002 1:6246464-6246486 CAACCCAAGCTGCCCCTCGCTGG - Intergenic
903387278 1:22935687-22935709 CACCCCTAGGTGCCATTTAGAGG - Intergenic
903650674 1:24919757-24919779 CCCCCCACGGTTCCACTAGCTGG + Intronic
904338041 1:29810558-29810580 CACCCCAAGAAGGCACTGGCCGG + Intergenic
904606735 1:31702064-31702086 CACCCCAGGATACCAGTTGCAGG + Intronic
905940856 1:41862124-41862146 CACCCAAAGGTGGCACTGACTGG + Intronic
907706638 1:56838296-56838318 TACCCCAAGGTGACACTCCCTGG + Intergenic
914846037 1:151283822-151283844 CAATCCCAGCTGCCACTTGCTGG + Intronic
915674213 1:157515616-157515638 CACCCCAAAGTTCCCCTTGGGGG - Exonic
922796472 1:228342044-228342066 CACCCCCAGGTGCACCTGGCAGG - Intronic
924024084 1:239814694-239814716 CACCCTCAGCAGCCACTTGCTGG - Intronic
1064104916 10:12492749-12492771 CACCCCAAGGAGTCAGTTGTGGG + Intronic
1065637865 10:27749051-27749073 CACCCAAAGCTGGCAATTGCAGG + Intergenic
1066364773 10:34766273-34766295 CACCCAAAGCTGACACTAGCAGG + Intronic
1066823709 10:39533080-39533102 CGCTCCAAGTTTCCACTTGCAGG - Intergenic
1068169687 10:53377661-53377683 TAACCCAAGTTGCCACTTGTTGG + Intergenic
1073645167 10:105294046-105294068 CACCCCCACGTGCCACTTGTGGG + Intergenic
1076195212 10:128512932-128512954 CATCCCCAGGTGGCACTGGCGGG + Intergenic
1076640654 10:131914493-131914515 GACCCCAAGGTTCCACTTGTAGG + Intronic
1077163378 11:1123843-1123865 CACCCCAAGGAACCACCTCCTGG - Intergenic
1080847173 11:36036591-36036613 AAGTCCAATGTGCCACTTGCTGG - Intronic
1083170773 11:60922955-60922977 CCCAGCAAGGTCCCACTTGCAGG - Exonic
1083294953 11:61710258-61710280 CTCTCCTAGGAGCCACTTGCTGG - Intronic
1083686309 11:64377846-64377868 CCTCCCAAAGTGCCACTTACAGG + Intergenic
1084730862 11:71072514-71072536 CACATCAAGGTTCCACTTGTGGG + Intronic
1090776115 11:129967706-129967728 CACCCCATGGCGACACTTGCAGG + Intronic
1092075054 12:5665863-5665885 CACCCCCCTGTGCCACTGGCTGG + Intronic
1092271182 12:7024645-7024667 CCCCCCAAAGTGCCAATTACAGG - Intronic
1095940075 12:47720922-47720944 CTCCCCAGGGTGCCTCCTGCAGG + Intronic
1102191987 12:110995478-110995500 CAGCCTAAGGTGGCACTTTCTGG - Intergenic
1103921899 12:124403526-124403548 CACCCCAAGGTCCTCCCTGCAGG + Intronic
1103961234 12:124610353-124610375 CACCCCGAAGGGCCATTTGCGGG + Intergenic
1105798303 13:23879950-23879972 CACCCCATAGTACCACTAGCAGG + Intronic
1106568404 13:30906300-30906322 CCTCCCAAGCTGCCACTCGCTGG - Exonic
1106580875 13:31017216-31017238 CAGCCCAAGGTTCACCTTGCAGG - Intergenic
1112656416 13:101456343-101456365 CAGCCCTAGGTGCTACTTGTAGG - Intronic
1122502761 14:102212338-102212360 CTCCCCAAGGCCCCTCTTGCTGG + Intronic
1122580770 14:102770344-102770366 CTCCCCCAGCTCCCACTTGCTGG + Intergenic
1125091029 15:35793005-35793027 CACCCCAACATGCCACCTGCAGG - Intergenic
1125348090 15:38740156-38740178 AACCCCAAAGGACCACTTGCAGG + Intergenic
1128231270 15:66037096-66037118 CACTCGGAGCTGCCACTTGCAGG - Intronic
1131798816 15:96048503-96048525 CTTCCCAACGTGCCACCTGCAGG + Intergenic
1132421361 15:101672766-101672788 CACCCCACGGAGACACTTCCGGG + Intronic
1142105241 16:88299094-88299116 CACCCCAAGCTGCCTCCTCCAGG - Intergenic
1142105253 16:88299127-88299149 CACCCCAAGCTGCCTCCTCCAGG - Intergenic
1142105276 16:88299192-88299214 CACCCCAAGCTGCCTCCTCCAGG - Intergenic
1142262138 16:89048023-89048045 CACCCCTAGGTCCCACCTGACGG - Intergenic
1143676480 17:8436340-8436362 CAGCCCACGGTGCCACGTCCCGG - Intronic
1149005321 17:51799105-51799127 CACAGCAAAGTACCACTTGCTGG + Intronic
1152089200 17:78237600-78237622 CAGCCCAAGGCCCCACTTCCTGG - Intronic
1154945323 18:21157088-21157110 CACCCACATGTGCCACTTGGGGG - Intergenic
1158207206 18:55006527-55006549 CATCCCAAGCTACCACTTGGTGG - Intergenic
1161550939 19:4911715-4911737 CACCCCCAGGTGCCAATGGAGGG - Intronic
1161791527 19:6362681-6362703 CACCAAAAGGTGCCTGTTGCTGG + Intronic
1161944769 19:7428750-7428772 CACCCAAAGGTTCGACCTGCAGG - Intronic
1162127230 19:8506156-8506178 CAGCCCCAGCTGTCACTTGCAGG - Intergenic
1163437600 19:17304659-17304681 AACCCCAAGCTGGCACTTGTAGG + Intronic
1165050602 19:33139193-33139215 CACCCCAAGGTGCAGCAGGCAGG + Intronic
1165325727 19:35113428-35113450 TACGCCAAGGTCCCACTTCCTGG - Intergenic
1166673206 19:44723875-44723897 CTCCCCCAGCTGCCACATGCAGG + Intergenic
1166843167 19:45711364-45711386 CACCCCAAGGACCCACCAGCAGG - Exonic
924965552 2:73352-73374 CTCCCCAAGGTGACTCTGGCAGG + Intergenic
925901088 2:8509979-8510001 CACCCCAATGTACCACTTTGGGG - Intergenic
926380377 2:12281068-12281090 CACCTAGAGGTGCCACTTCCTGG + Intergenic
928213948 2:29345601-29345623 AACCCCAAGGTTCCACTTTTAGG + Intronic
930173220 2:48273180-48273202 ATCCCCACGGTGCCACTTGGAGG - Intergenic
930331363 2:49989216-49989238 GACCCCAAGGTTTCACTTGGTGG - Intronic
930847642 2:55923261-55923283 CAGCCCAAGGTACCAGTTTCGGG + Intronic
930857662 2:56036452-56036474 CATGCCAAGGTGGCACGTGCCGG - Intergenic
932820114 2:74892346-74892368 AAACCCAAGGTGAAACTTGCTGG - Exonic
948119348 2:235517279-235517301 CACCCCAAGGTGACTGTCGCTGG - Intronic
948834542 2:240619836-240619858 CACTCCTAAGTGCCACTTCCTGG - Intronic
1170480655 20:16761861-16761883 CACCCCATGGTGCCCCTGGAGGG - Intronic
1171948156 20:31396820-31396842 CACCCCAAGGTAGCAGGTGCTGG - Intergenic
1173852779 20:46229166-46229188 CAGCTCCAGGTGCCTCTTGCTGG + Intronic
1174426600 20:50435983-50436005 CACCGCTAGCTGCCACGTGCTGG - Intergenic
1175193382 20:57226037-57226059 CAGCCCAAGTTGCCTGTTGCCGG + Intronic
1175975311 20:62707936-62707958 CAGCCCAGGGTGCCAGATGCAGG + Intergenic
1176359456 21:5982811-5982833 CACCCATATGTGCCACCTGCAGG - Intergenic
1179764062 21:43555739-43555761 CACCCATATGTGCCACCTGCAGG + Intronic
1180935194 22:19620803-19620825 CATCACAAAGTGCCACTGGCTGG - Intergenic
1184308671 22:43627106-43627128 CACACCAAGGAGCCACCTGAAGG + Intronic
1185276947 22:49953931-49953953 CACCCACAGGTGCCCCTTCCTGG + Intergenic
1185402768 22:50627241-50627263 CACCCCAAGGTGCCACTTGCCGG + Exonic
952154319 3:30626558-30626580 CACCCCAGGCAGCCACTTGCCGG - Intronic
960861090 3:122154310-122154332 CACCCCCATGTGCCACCTGCAGG + Intergenic
968454195 4:688892-688914 CAGCCCGAGGTGCCAGGTGCTGG - Intronic
968757552 4:2424673-2424695 AGCCCCAAGGTGACACTGGCTGG - Intronic
968905557 4:3449154-3449176 GTCCCCAAGCTGCCACTTGGGGG + Intronic
969688797 4:8692017-8692039 CACCCCTAGGTGCCCCTTAGAGG - Intergenic
975763708 4:77643754-77643776 CACCCAAAGGTACAACTTACTGG + Intergenic
978613678 4:110571973-110571995 CACCCACATGTGCCACTTGTGGG + Intergenic
983857479 4:172663489-172663511 AACCCCAAGGTCCCACTAGTCGG + Intronic
985480870 5:109473-109495 CACCCCCAGGTGCCACACCCTGG + Intergenic
985664888 5:1176929-1176951 CACCCCCAGGTGCCCTTTCCAGG - Intergenic
992021641 5:72630554-72630576 CACAGCAAAGTGTCACTTGCCGG - Intergenic
997709438 5:135991245-135991267 CACCCCAAGGCGCCACTTTCAGG - Intergenic
999255280 5:150206572-150206594 CACCACAAGGCTCCACCTGCAGG + Intronic
999936078 5:156486816-156486838 CACCCACATGTGCCACTTGGGGG + Intronic
1006335467 6:33418292-33418314 AACCCGAAACTGCCACTTGCTGG + Exonic
1006518681 6:34558914-34558936 CACCCCAAGCAGCCTCTTGGAGG - Intergenic
1007165221 6:39824297-39824319 GACCCCAAGATGCCCCCTGCTGG - Intronic
1008289480 6:49696246-49696268 TACCCCAAGGTGCCAATTAGGGG + Intronic
1013429501 6:110043031-110043053 CACCCCTAGGTGCCCTTTGGAGG - Intergenic
1018303629 6:162430204-162430226 CACCCCATGATGTCAGTTGCTGG - Intronic
1019195367 6:170278567-170278589 TACACCAGGGTGCCACTTGGGGG + Intergenic
1019405156 7:879284-879306 CACGCCGCGGTGCCACGTGCTGG + Intronic
1021936189 7:25634003-25634025 CACCCCAAGGTTACTCTTGCAGG + Intergenic
1025222961 7:57132091-57132113 AACCCCAGGGTGCCAGGTGCTGG + Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029705836 7:102275178-102275200 CACCCCAAAGGGCCGCCTGCTGG + Intronic
1032024246 7:128429008-128429030 CACCCCCAGGTGTTATTTGCAGG + Intergenic
1032084192 7:128874965-128874987 CACTCCACGCTGCCACTTGTAGG - Intronic
1035535011 8:384271-384293 CTCCCCAACGTGTCCCTTGCGGG - Intergenic
1039677893 8:39690264-39690286 CTGCCCATGGTGCCACATGCTGG - Intronic
1048031521 8:130637871-130637893 CACCACAAGGAACCACTTGAAGG - Intergenic
1049196838 8:141320460-141320482 CACCCCAACGTGCCCCGTGTTGG - Intergenic
1049662945 8:143828578-143828600 CCACCCAGGGTGCCATTTGCTGG - Intronic
1050094299 9:2047498-2047520 CACCGCAGGGGGCCCCTTGCTGG - Intronic
1053415422 9:37944277-37944299 CAGCCCAAGCTGCCACCTGTCGG - Intronic
1056311341 9:85344119-85344141 CATCCCAAGTTCCCACTTACCGG + Intergenic
1060007800 9:120015692-120015714 CCCACCAGGGTGCCACGTGCTGG + Intergenic
1061234195 9:129332956-129332978 CACGCCAAAGTGCCACCAGCAGG - Intergenic
1061924065 9:133797381-133797403 GAGCCCCAGGTGCCATTTGCTGG - Intronic
1062389437 9:136328038-136328060 CACCCCACGGTGCCCCTGCCAGG - Intronic
1203404629 Un_KI270507v1:2297-2319 CACTCCAAATTTCCACTTGCAGG - Intergenic
1187721105 X:22151609-22151631 CTCCCCGAGGTGCCATTTTCTGG + Intronic
1193359973 X:80570445-80570467 AAACCCAAGGTGAAACTTGCTGG + Intergenic
1194439961 X:93920291-93920313 CACCCCAAAGGGACCCTTGCTGG - Intergenic
1194921957 X:99778293-99778315 CACCCCAAGAGCCCACTTGGTGG + Intergenic
1195129786 X:101840701-101840723 CACCCACAGGTGCCACTGCCTGG + Intronic
1195176450 X:102319122-102319144 CACCCACAGGTGCCACTGCCTGG - Intronic
1195182414 X:102367971-102367993 CACCCACAGGTGCCACTGCCTGG + Intronic
1196859989 X:120017474-120017496 CTCCTCAAGCTGCCTCTTGCAGG + Intergenic
1197325973 X:125094015-125094037 TACCACAAGGTGCCACCTTCAGG + Intergenic