ID: 1185409625

View in Genome Browser
Species Human (GRCh38)
Location 22:50674864-50674886
Sequence CCCAGGGGCCGGGCTTCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185409625_1185409648 25 Left 1185409625 22:50674864-50674886 CCCCGGGAAGCCCGGCCCCTGGG No data
Right 1185409648 22:50674912-50674934 AGGCGCGGGGTCCCGGGCGCCGG No data
1185409625_1185409639 -5 Left 1185409625 22:50674864-50674886 CCCCGGGAAGCCCGGCCCCTGGG No data
Right 1185409639 22:50674882-50674904 CTGGGGCGGGGCTTCGGCCGCGG No data
1185409625_1185409646 18 Left 1185409625 22:50674864-50674886 CCCCGGGAAGCCCGGCCCCTGGG No data
Right 1185409646 22:50674905-50674927 TTCGCGGAGGCGCGGGGTCCCGG No data
1185409625_1185409643 11 Left 1185409625 22:50674864-50674886 CCCCGGGAAGCCCGGCCCCTGGG No data
Right 1185409643 22:50674898-50674920 GCCGCGGTTCGCGGAGGCGCGGG No data
1185409625_1185409642 10 Left 1185409625 22:50674864-50674886 CCCCGGGAAGCCCGGCCCCTGGG No data
Right 1185409642 22:50674897-50674919 GGCCGCGGTTCGCGGAGGCGCGG No data
1185409625_1185409647 19 Left 1185409625 22:50674864-50674886 CCCCGGGAAGCCCGGCCCCTGGG No data
Right 1185409647 22:50674906-50674928 TCGCGGAGGCGCGGGGTCCCGGG No data
1185409625_1185409641 5 Left 1185409625 22:50674864-50674886 CCCCGGGAAGCCCGGCCCCTGGG No data
Right 1185409641 22:50674892-50674914 GCTTCGGCCGCGGTTCGCGGAGG No data
1185409625_1185409645 12 Left 1185409625 22:50674864-50674886 CCCCGGGAAGCCCGGCCCCTGGG No data
Right 1185409645 22:50674899-50674921 CCGCGGTTCGCGGAGGCGCGGGG No data
1185409625_1185409640 2 Left 1185409625 22:50674864-50674886 CCCCGGGAAGCCCGGCCCCTGGG No data
Right 1185409640 22:50674889-50674911 GGGGCTTCGGCCGCGGTTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185409625 Original CRISPR CCCAGGGGCCGGGCTTCCCG GGG (reversed) Intergenic
No off target data available for this crispr