ID: 1185412165

View in Genome Browser
Species Human (GRCh38)
Location 22:50688500-50688522
Sequence TGCCCACTGGGGTCCCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185412160_1185412165 12 Left 1185412160 22:50688465-50688487 CCAAGGACAGGACAGTCATGACT No data
Right 1185412165 22:50688500-50688522 TGCCCACTGGGGTCCCAGAGTGG No data
1185412156_1185412165 30 Left 1185412156 22:50688447-50688469 CCTCCGTACACATTTGCTCCAAG No data
Right 1185412165 22:50688500-50688522 TGCCCACTGGGGTCCCAGAGTGG No data
1185412158_1185412165 27 Left 1185412158 22:50688450-50688472 CCGTACACATTTGCTCCAAGGAC No data
Right 1185412165 22:50688500-50688522 TGCCCACTGGGGTCCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185412165 Original CRISPR TGCCCACTGGGGTCCCAGAG TGG Intergenic
No off target data available for this crispr