ID: 1185413588

View in Genome Browser
Species Human (GRCh38)
Location 22:50698090-50698112
Sequence CAGACACCCCACGACGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185413588_1185413596 23 Left 1185413588 22:50698090-50698112 CCCTTGCCGTCGTGGGGTGTCTG No data
Right 1185413596 22:50698136-50698158 TTATGCAGGCTTCTGTCACCGGG No data
1185413588_1185413594 9 Left 1185413588 22:50698090-50698112 CCCTTGCCGTCGTGGGGTGTCTG No data
Right 1185413594 22:50698122-50698144 TGTGGGTGTTTGTGTTATGCAGG No data
1185413588_1185413595 22 Left 1185413588 22:50698090-50698112 CCCTTGCCGTCGTGGGGTGTCTG No data
Right 1185413595 22:50698135-50698157 GTTATGCAGGCTTCTGTCACCGG No data
1185413588_1185413597 24 Left 1185413588 22:50698090-50698112 CCCTTGCCGTCGTGGGGTGTCTG No data
Right 1185413597 22:50698137-50698159 TATGCAGGCTTCTGTCACCGGGG No data
1185413588_1185413591 -9 Left 1185413588 22:50698090-50698112 CCCTTGCCGTCGTGGGGTGTCTG No data
Right 1185413591 22:50698104-50698126 GGGTGTCTGTGACCGTCATGTGG No data
1185413588_1185413592 -8 Left 1185413588 22:50698090-50698112 CCCTTGCCGTCGTGGGGTGTCTG No data
Right 1185413592 22:50698105-50698127 GGTGTCTGTGACCGTCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185413588 Original CRISPR CAGACACCCCACGACGGCAA GGG (reversed) Intergenic
No off target data available for this crispr