ID: 1185413592

View in Genome Browser
Species Human (GRCh38)
Location 22:50698105-50698127
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185413583_1185413592 9 Left 1185413583 22:50698073-50698095 CCCTGCGATGTGGGGGACCCTTG No data
Right 1185413592 22:50698105-50698127 GGTGTCTGTGACCGTCATGTGGG No data
1185413577_1185413592 20 Left 1185413577 22:50698062-50698084 CCATTGGAGGCCCCTGCGATGTG No data
Right 1185413592 22:50698105-50698127 GGTGTCTGTGACCGTCATGTGGG No data
1185413589_1185413592 -9 Left 1185413589 22:50698091-50698113 CCTTGCCGTCGTGGGGTGTCTGT No data
Right 1185413592 22:50698105-50698127 GGTGTCTGTGACCGTCATGTGGG No data
1185413584_1185413592 8 Left 1185413584 22:50698074-50698096 CCTGCGATGTGGGGGACCCTTGC No data
Right 1185413592 22:50698105-50698127 GGTGTCTGTGACCGTCATGTGGG No data
1185413588_1185413592 -8 Left 1185413588 22:50698090-50698112 CCCTTGCCGTCGTGGGGTGTCTG No data
Right 1185413592 22:50698105-50698127 GGTGTCTGTGACCGTCATGTGGG No data
1185413582_1185413592 10 Left 1185413582 22:50698072-50698094 CCCCTGCGATGTGGGGGACCCTT No data
Right 1185413592 22:50698105-50698127 GGTGTCTGTGACCGTCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185413592 Original CRISPR GGTGTCTGTGACCGTCATGT GGG Intergenic