ID: 1185413595

View in Genome Browser
Species Human (GRCh38)
Location 22:50698135-50698157
Sequence GTTATGCAGGCTTCTGTCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185413588_1185413595 22 Left 1185413588 22:50698090-50698112 CCCTTGCCGTCGTGGGGTGTCTG No data
Right 1185413595 22:50698135-50698157 GTTATGCAGGCTTCTGTCACCGG No data
1185413593_1185413595 -4 Left 1185413593 22:50698116-50698138 CCGTCATGTGGGTGTTTGTGTTA No data
Right 1185413595 22:50698135-50698157 GTTATGCAGGCTTCTGTCACCGG No data
1185413589_1185413595 21 Left 1185413589 22:50698091-50698113 CCTTGCCGTCGTGGGGTGTCTGT No data
Right 1185413595 22:50698135-50698157 GTTATGCAGGCTTCTGTCACCGG No data
1185413590_1185413595 16 Left 1185413590 22:50698096-50698118 CCGTCGTGGGGTGTCTGTGACCG No data
Right 1185413595 22:50698135-50698157 GTTATGCAGGCTTCTGTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185413595 Original CRISPR GTTATGCAGGCTTCTGTCAC CGG Intergenic