ID: 1185414265

View in Genome Browser
Species Human (GRCh38)
Location 22:50701150-50701172
Sequence GACATAGTCCCTGTGCGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185414255_1185414265 29 Left 1185414255 22:50701098-50701120 CCATTTCCGGGACTGGAGTGGGG No data
Right 1185414265 22:50701150-50701172 GACATAGTCCCTGTGCGTGCAGG No data
1185414257_1185414265 23 Left 1185414257 22:50701104-50701126 CCGGGACTGGAGTGGGGACAGAA No data
Right 1185414265 22:50701150-50701172 GACATAGTCCCTGTGCGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185414265 Original CRISPR GACATAGTCCCTGTGCGTGC AGG Intergenic
No off target data available for this crispr