ID: 1185414391

View in Genome Browser
Species Human (GRCh38)
Location 22:50701789-50701811
Sequence TATATGGGCGGGCTTAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185414383_1185414391 -2 Left 1185414383 22:50701768-50701790 CCAAGTTGGATTTCTCTATTCTA No data
Right 1185414391 22:50701789-50701811 TATATGGGCGGGCTTAGAGGGGG No data
1185414381_1185414391 11 Left 1185414381 22:50701755-50701777 CCAAGGGGATCCTCCAAGTTGGA No data
Right 1185414391 22:50701789-50701811 TATATGGGCGGGCTTAGAGGGGG No data
1185414382_1185414391 1 Left 1185414382 22:50701765-50701787 CCTCCAAGTTGGATTTCTCTATT No data
Right 1185414391 22:50701789-50701811 TATATGGGCGGGCTTAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185414391 Original CRISPR TATATGGGCGGGCTTAGAGG GGG Intergenic
No off target data available for this crispr