ID: 1185415337

View in Genome Browser
Species Human (GRCh38)
Location 22:50706227-50706249
Sequence AGGTGGTACGGGAGGGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185415326_1185415337 7 Left 1185415326 22:50706197-50706219 CCATGATGGGCAGACAGGGCCGG No data
Right 1185415337 22:50706227-50706249 AGGTGGTACGGGAGGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185415337 Original CRISPR AGGTGGTACGGGAGGGCAGG CGG Intergenic
No off target data available for this crispr