ID: 1185416790

View in Genome Browser
Species Human (GRCh38)
Location 22:50715033-50715055
Sequence GCCCTTACGCTAATCTCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185416790_1185416802 5 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416802 22:50715061-50715083 GCGGCTGGGAGCGCTGGGTCGGG No data
1185416790_1185416797 -9 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416797 22:50715047-50715069 CGTAAGGGCCACGGGCGGCTGGG No data
1185416790_1185416800 0 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416800 22:50715056-50715078 CACGGGCGGCTGGGAGCGCTGGG No data
1185416790_1185416807 17 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416807 22:50715073-50715095 GCTGGGTCGGGCAGGCATGGGGG No data
1185416790_1185416801 4 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416801 22:50715060-50715082 GGCGGCTGGGAGCGCTGGGTCGG No data
1185416790_1185416805 15 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416805 22:50715071-50715093 GCGCTGGGTCGGGCAGGCATGGG No data
1185416790_1185416803 9 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416803 22:50715065-50715087 CTGGGAGCGCTGGGTCGGGCAGG No data
1185416790_1185416804 14 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416804 22:50715070-50715092 AGCGCTGGGTCGGGCAGGCATGG No data
1185416790_1185416799 -1 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416799 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
1185416790_1185416796 -10 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416796 22:50715046-50715068 GCGTAAGGGCCACGGGCGGCTGG No data
1185416790_1185416806 16 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416806 22:50715072-50715094 CGCTGGGTCGGGCAGGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185416790 Original CRISPR GCCCTTACGCTAATCTCGGC GGG (reversed) Intergenic