ID: 1185416791

View in Genome Browser
Species Human (GRCh38)
Location 22:50715034-50715056
Sequence GGCCCTTACGCTAATCTCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185416791_1185416803 8 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416803 22:50715065-50715087 CTGGGAGCGCTGGGTCGGGCAGG No data
1185416791_1185416802 4 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416802 22:50715061-50715083 GCGGCTGGGAGCGCTGGGTCGGG No data
1185416791_1185416801 3 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416801 22:50715060-50715082 GGCGGCTGGGAGCGCTGGGTCGG No data
1185416791_1185416799 -2 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416799 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
1185416791_1185416800 -1 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416800 22:50715056-50715078 CACGGGCGGCTGGGAGCGCTGGG No data
1185416791_1185416807 16 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416807 22:50715073-50715095 GCTGGGTCGGGCAGGCATGGGGG No data
1185416791_1185416797 -10 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416797 22:50715047-50715069 CGTAAGGGCCACGGGCGGCTGGG No data
1185416791_1185416806 15 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416806 22:50715072-50715094 CGCTGGGTCGGGCAGGCATGGGG No data
1185416791_1185416805 14 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416805 22:50715071-50715093 GCGCTGGGTCGGGCAGGCATGGG No data
1185416791_1185416804 13 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416804 22:50715070-50715092 AGCGCTGGGTCGGGCAGGCATGG No data
1185416791_1185416808 30 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416808 22:50715087-50715109 GCATGGGGGTCAGACTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185416791 Original CRISPR GGCCCTTACGCTAATCTCGG CGG (reversed) Intergenic