ID: 1185416792

View in Genome Browser
Species Human (GRCh38)
Location 22:50715037-50715059
Sequence CGTGGCCCTTACGCTAATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185416792_1185416803 5 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416803 22:50715065-50715087 CTGGGAGCGCTGGGTCGGGCAGG No data
1185416792_1185416802 1 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416802 22:50715061-50715083 GCGGCTGGGAGCGCTGGGTCGGG No data
1185416792_1185416806 12 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416806 22:50715072-50715094 CGCTGGGTCGGGCAGGCATGGGG No data
1185416792_1185416809 28 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416809 22:50715088-50715110 CATGGGGGTCAGACTGTCCTGGG No data
1185416792_1185416805 11 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416805 22:50715071-50715093 GCGCTGGGTCGGGCAGGCATGGG No data
1185416792_1185416808 27 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416808 22:50715087-50715109 GCATGGGGGTCAGACTGTCCTGG No data
1185416792_1185416807 13 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416807 22:50715073-50715095 GCTGGGTCGGGCAGGCATGGGGG No data
1185416792_1185416801 0 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416801 22:50715060-50715082 GGCGGCTGGGAGCGCTGGGTCGG No data
1185416792_1185416804 10 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416804 22:50715070-50715092 AGCGCTGGGTCGGGCAGGCATGG No data
1185416792_1185416799 -5 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416799 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
1185416792_1185416800 -4 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416800 22:50715056-50715078 CACGGGCGGCTGGGAGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185416792 Original CRISPR CGTGGCCCTTACGCTAATCT CGG (reversed) Intergenic