ID: 1185416798

View in Genome Browser
Species Human (GRCh38)
Location 22:50715055-50715077
Sequence CCAGCGCTCCCAGCCGCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185416798_1185416808 9 Left 1185416798 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
Right 1185416808 22:50715087-50715109 GCATGGGGGTCAGACTGTCCTGG No data
1185416798_1185416809 10 Left 1185416798 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
Right 1185416809 22:50715088-50715110 CATGGGGGTCAGACTGTCCTGGG No data
1185416798_1185416807 -5 Left 1185416798 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
Right 1185416807 22:50715073-50715095 GCTGGGTCGGGCAGGCATGGGGG No data
1185416798_1185416804 -8 Left 1185416798 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
Right 1185416804 22:50715070-50715092 AGCGCTGGGTCGGGCAGGCATGG No data
1185416798_1185416810 22 Left 1185416798 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
Right 1185416810 22:50715100-50715122 ACTGTCCTGGGCCCTCTTGACGG No data
1185416798_1185416805 -7 Left 1185416798 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
Right 1185416805 22:50715071-50715093 GCGCTGGGTCGGGCAGGCATGGG No data
1185416798_1185416811 25 Left 1185416798 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
Right 1185416811 22:50715103-50715125 GTCCTGGGCCCTCTTGACGGAGG No data
1185416798_1185416806 -6 Left 1185416798 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
Right 1185416806 22:50715072-50715094 CGCTGGGTCGGGCAGGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185416798 Original CRISPR CCAGCGCTCCCAGCCGCCCG TGG (reversed) Intergenic