ID: 1185416805

View in Genome Browser
Species Human (GRCh38)
Location 22:50715071-50715093
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185416790_1185416805 15 Left 1185416790 22:50715033-50715055 CCCGCCGAGATTAGCGTAAGGGC No data
Right 1185416805 22:50715071-50715093 GCGCTGGGTCGGGCAGGCATGGG No data
1185416798_1185416805 -7 Left 1185416798 22:50715055-50715077 CCACGGGCGGCTGGGAGCGCTGG No data
Right 1185416805 22:50715071-50715093 GCGCTGGGTCGGGCAGGCATGGG No data
1185416791_1185416805 14 Left 1185416791 22:50715034-50715056 CCGCCGAGATTAGCGTAAGGGCC No data
Right 1185416805 22:50715071-50715093 GCGCTGGGTCGGGCAGGCATGGG No data
1185416792_1185416805 11 Left 1185416792 22:50715037-50715059 CCGAGATTAGCGTAAGGGCCACG No data
Right 1185416805 22:50715071-50715093 GCGCTGGGTCGGGCAGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185416805 Original CRISPR GCGCTGGGTCGGGCAGGCAT GGG Intergenic