ID: 1185417898

View in Genome Browser
Species Human (GRCh38)
Location 22:50720165-50720187
Sequence TCCCCTGCGGACGGAAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185417898_1185417905 3 Left 1185417898 22:50720165-50720187 CCGGCCCTTCCGTCCGCAGGGGA No data
Right 1185417905 22:50720191-50720213 CGAGAAGCTGGCGTCCCTGCTGG No data
1185417898_1185417910 20 Left 1185417898 22:50720165-50720187 CCGGCCCTTCCGTCCGCAGGGGA No data
Right 1185417910 22:50720208-50720230 TGCTGGAAGGGCGCTTCCCGCGG No data
1185417898_1185417904 -9 Left 1185417898 22:50720165-50720187 CCGGCCCTTCCGTCCGCAGGGGA No data
Right 1185417904 22:50720179-50720201 CGCAGGGGAGGACGAGAAGCTGG No data
1185417898_1185417907 8 Left 1185417898 22:50720165-50720187 CCGGCCCTTCCGTCCGCAGGGGA No data
Right 1185417907 22:50720196-50720218 AGCTGGCGTCCCTGCTGGAAGGG No data
1185417898_1185417906 7 Left 1185417898 22:50720165-50720187 CCGGCCCTTCCGTCCGCAGGGGA No data
Right 1185417906 22:50720195-50720217 AAGCTGGCGTCCCTGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185417898 Original CRISPR TCCCCTGCGGACGGAAGGGC CGG (reversed) Intergenic
No off target data available for this crispr