ID: 1185420083

View in Genome Browser
Species Human (GRCh38)
Location 22:50730357-50730379
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420083_1185420088 -3 Left 1185420083 22:50730357-50730379 CCCGGGTATCTGTGGATCCCGCC No data
Right 1185420088 22:50730377-50730399 GCCATGCCCAGAGCCGGTGTCGG No data
1185420083_1185420094 8 Left 1185420083 22:50730357-50730379 CCCGGGTATCTGTGGATCCCGCC No data
Right 1185420094 22:50730388-50730410 AGCCGGTGTCGGAGGCTGGCAGG No data
1185420083_1185420090 0 Left 1185420083 22:50730357-50730379 CCCGGGTATCTGTGGATCCCGCC No data
Right 1185420090 22:50730380-50730402 ATGCCCAGAGCCGGTGTCGGAGG No data
1185420083_1185420085 -9 Left 1185420083 22:50730357-50730379 CCCGGGTATCTGTGGATCCCGCC No data
Right 1185420085 22:50730371-50730393 GATCCCGCCATGCCCAGAGCCGG No data
1185420083_1185420093 4 Left 1185420083 22:50730357-50730379 CCCGGGTATCTGTGGATCCCGCC No data
Right 1185420093 22:50730384-50730406 CCAGAGCCGGTGTCGGAGGCTGG No data
1185420083_1185420097 12 Left 1185420083 22:50730357-50730379 CCCGGGTATCTGTGGATCCCGCC No data
Right 1185420097 22:50730392-50730414 GGTGTCGGAGGCTGGCAGGAGGG No data
1185420083_1185420096 11 Left 1185420083 22:50730357-50730379 CCCGGGTATCTGTGGATCCCGCC No data
Right 1185420096 22:50730391-50730413 CGGTGTCGGAGGCTGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420083 Original CRISPR GGCGGGATCCACAGATACCC GGG (reversed) Intergenic
No off target data available for this crispr