ID: 1185420089

View in Genome Browser
Species Human (GRCh38)
Location 22:50730378-50730400
Sequence TCCGACACCGGCTCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420089_1185420097 -9 Left 1185420089 22:50730378-50730400 CCATGCCCAGAGCCGGTGTCGGA No data
Right 1185420097 22:50730392-50730414 GGTGTCGGAGGCTGGCAGGAGGG No data
1185420089_1185420098 17 Left 1185420089 22:50730378-50730400 CCATGCCCAGAGCCGGTGTCGGA No data
Right 1185420098 22:50730418-50730440 AGCCCGCCCTTTGCCATGAGAGG No data
1185420089_1185420096 -10 Left 1185420089 22:50730378-50730400 CCATGCCCAGAGCCGGTGTCGGA No data
Right 1185420096 22:50730391-50730413 CGGTGTCGGAGGCTGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420089 Original CRISPR TCCGACACCGGCTCTGGGCA TGG (reversed) Intergenic