ID: 1185420093

View in Genome Browser
Species Human (GRCh38)
Location 22:50730384-50730406
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420084_1185420093 3 Left 1185420084 22:50730358-50730380 CCGGGTATCTGTGGATCCCGCCA No data
Right 1185420093 22:50730384-50730406 CCAGAGCCGGTGTCGGAGGCTGG No data
1185420081_1185420093 18 Left 1185420081 22:50730343-50730365 CCAAGTCTCAGCGTCCCGGGTAT No data
Right 1185420093 22:50730384-50730406 CCAGAGCCGGTGTCGGAGGCTGG No data
1185420083_1185420093 4 Left 1185420083 22:50730357-50730379 CCCGGGTATCTGTGGATCCCGCC No data
Right 1185420093 22:50730384-50730406 CCAGAGCCGGTGTCGGAGGCTGG No data
1185420080_1185420093 19 Left 1185420080 22:50730342-50730364 CCCAAGTCTCAGCGTCCCGGGTA No data
Right 1185420093 22:50730384-50730406 CCAGAGCCGGTGTCGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420093 Original CRISPR CCAGAGCCGGTGTCGGAGGC TGG Intergenic