ID: 1185420096

View in Genome Browser
Species Human (GRCh38)
Location 22:50730391-50730413
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420084_1185420096 10 Left 1185420084 22:50730358-50730380 CCGGGTATCTGTGGATCCCGCCA No data
Right 1185420096 22:50730391-50730413 CGGTGTCGGAGGCTGGCAGGAGG No data
1185420086_1185420096 -6 Left 1185420086 22:50730374-50730396 CCCGCCATGCCCAGAGCCGGTGT No data
Right 1185420096 22:50730391-50730413 CGGTGTCGGAGGCTGGCAGGAGG No data
1185420081_1185420096 25 Left 1185420081 22:50730343-50730365 CCAAGTCTCAGCGTCCCGGGTAT No data
Right 1185420096 22:50730391-50730413 CGGTGTCGGAGGCTGGCAGGAGG No data
1185420087_1185420096 -7 Left 1185420087 22:50730375-50730397 CCGCCATGCCCAGAGCCGGTGTC 0: 1
1: 0
2: 0
3: 20
4: 269
Right 1185420096 22:50730391-50730413 CGGTGTCGGAGGCTGGCAGGAGG No data
1185420083_1185420096 11 Left 1185420083 22:50730357-50730379 CCCGGGTATCTGTGGATCCCGCC No data
Right 1185420096 22:50730391-50730413 CGGTGTCGGAGGCTGGCAGGAGG No data
1185420080_1185420096 26 Left 1185420080 22:50730342-50730364 CCCAAGTCTCAGCGTCCCGGGTA No data
Right 1185420096 22:50730391-50730413 CGGTGTCGGAGGCTGGCAGGAGG No data
1185420089_1185420096 -10 Left 1185420089 22:50730378-50730400 CCATGCCCAGAGCCGGTGTCGGA 0: 1
1: 0
2: 1
3: 5
4: 81
Right 1185420096 22:50730391-50730413 CGGTGTCGGAGGCTGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420096 Original CRISPR CGGTGTCGGAGGCTGGCAGG AGG Intergenic