ID: 1185420098

View in Genome Browser
Species Human (GRCh38)
Location 22:50730418-50730440
Sequence AGCCCGCCCTTTGCCATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420087_1185420098 20 Left 1185420087 22:50730375-50730397 CCGCCATGCCCAGAGCCGGTGTC No data
Right 1185420098 22:50730418-50730440 AGCCCGCCCTTTGCCATGAGAGG No data
1185420095_1185420098 5 Left 1185420095 22:50730390-50730412 CCGGTGTCGGAGGCTGGCAGGAG No data
Right 1185420098 22:50730418-50730440 AGCCCGCCCTTTGCCATGAGAGG No data
1185420089_1185420098 17 Left 1185420089 22:50730378-50730400 CCATGCCCAGAGCCGGTGTCGGA No data
Right 1185420098 22:50730418-50730440 AGCCCGCCCTTTGCCATGAGAGG No data
1185420091_1185420098 12 Left 1185420091 22:50730383-50730405 CCCAGAGCCGGTGTCGGAGGCTG No data
Right 1185420098 22:50730418-50730440 AGCCCGCCCTTTGCCATGAGAGG No data
1185420092_1185420098 11 Left 1185420092 22:50730384-50730406 CCAGAGCCGGTGTCGGAGGCTGG No data
Right 1185420098 22:50730418-50730440 AGCCCGCCCTTTGCCATGAGAGG No data
1185420086_1185420098 21 Left 1185420086 22:50730374-50730396 CCCGCCATGCCCAGAGCCGGTGT No data
Right 1185420098 22:50730418-50730440 AGCCCGCCCTTTGCCATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420098 Original CRISPR AGCCCGCCCTTTGCCATGAG AGG Intergenic