ID: 1185420193

View in Genome Browser
Species Human (GRCh38)
Location 22:50730761-50730783
Sequence CAGCGCAGCCCCGGGGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420182_1185420193 27 Left 1185420182 22:50730711-50730733 CCCTCCGCAGGCTCTTCAGCAGC No data
Right 1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG No data
1185420186_1185420193 5 Left 1185420186 22:50730733-50730755 CCTCGGTGAGCTGAGCTCCATTT No data
Right 1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG No data
1185420184_1185420193 23 Left 1185420184 22:50730715-50730737 CCGCAGGCTCTTCAGCAGCCTCG No data
Right 1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG No data
1185420183_1185420193 26 Left 1185420183 22:50730712-50730734 CCTCCGCAGGCTCTTCAGCAGCC No data
Right 1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420193 Original CRISPR CAGCGCAGCCCCGGGGGCCC GGG Intergenic
No off target data available for this crispr