ID: 1185420608

View in Genome Browser
Species Human (GRCh38)
Location 22:50732308-50732330
Sequence GGGGCCGCTCTGGACTAGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420599_1185420608 10 Left 1185420599 22:50732275-50732297 CCGTGTGTGTGCCTGATTACTGA No data
Right 1185420608 22:50732308-50732330 GGGGCCGCTCTGGACTAGCGCGG No data
1185420601_1185420608 -1 Left 1185420601 22:50732286-50732308 CCTGATTACTGAGTGGCCACCAG No data
Right 1185420608 22:50732308-50732330 GGGGCCGCTCTGGACTAGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420608 Original CRISPR GGGGCCGCTCTGGACTAGCG CGG Intergenic
No off target data available for this crispr