ID: 1185420627

View in Genome Browser
Species Human (GRCh38)
Location 22:50732413-50732435
Sequence GCTGGACCCAGGGTGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420627_1185420637 22 Left 1185420627 22:50732413-50732435 CCATCCTGCACCCTGGGTCCAGC No data
Right 1185420637 22:50732458-50732480 AGAGCCTCACCCAGCCTGAGCGG No data
1185420627_1185420638 23 Left 1185420627 22:50732413-50732435 CCATCCTGCACCCTGGGTCCAGC No data
Right 1185420638 22:50732459-50732481 GAGCCTCACCCAGCCTGAGCGGG No data
1185420627_1185420639 24 Left 1185420627 22:50732413-50732435 CCATCCTGCACCCTGGGTCCAGC No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420627 Original CRISPR GCTGGACCCAGGGTGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr