ID: 1185420629

View in Genome Browser
Species Human (GRCh38)
Location 22:50732423-50732445
Sequence TGGGCAAACAGCTGGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420629_1185420637 12 Left 1185420629 22:50732423-50732445 CCCTGGGTCCAGCTGTTTGCCCA No data
Right 1185420637 22:50732458-50732480 AGAGCCTCACCCAGCCTGAGCGG No data
1185420629_1185420643 22 Left 1185420629 22:50732423-50732445 CCCTGGGTCCAGCTGTTTGCCCA No data
Right 1185420643 22:50732468-50732490 CCAGCCTGAGCGGGGTTCCCTGG No data
1185420629_1185420638 13 Left 1185420629 22:50732423-50732445 CCCTGGGTCCAGCTGTTTGCCCA No data
Right 1185420638 22:50732459-50732481 GAGCCTCACCCAGCCTGAGCGGG No data
1185420629_1185420639 14 Left 1185420629 22:50732423-50732445 CCCTGGGTCCAGCTGTTTGCCCA No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420629 Original CRISPR TGGGCAAACAGCTGGACCCA GGG (reversed) Intergenic
No off target data available for this crispr