ID: 1185420631

View in Genome Browser
Species Human (GRCh38)
Location 22:50732431-50732453
Sequence GGACAGGCTGGGCAAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420631_1185420639 6 Left 1185420631 22:50732431-50732453 CCAGCTGTTTGCCCAGCCTGTCC No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data
1185420631_1185420638 5 Left 1185420631 22:50732431-50732453 CCAGCTGTTTGCCCAGCCTGTCC No data
Right 1185420638 22:50732459-50732481 GAGCCTCACCCAGCCTGAGCGGG No data
1185420631_1185420643 14 Left 1185420631 22:50732431-50732453 CCAGCTGTTTGCCCAGCCTGTCC No data
Right 1185420643 22:50732468-50732490 CCAGCCTGAGCGGGGTTCCCTGG No data
1185420631_1185420637 4 Left 1185420631 22:50732431-50732453 CCAGCTGTTTGCCCAGCCTGTCC No data
Right 1185420637 22:50732458-50732480 AGAGCCTCACCCAGCCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420631 Original CRISPR GGACAGGCTGGGCAAACAGC TGG (reversed) Intergenic
No off target data available for this crispr