ID: 1185420633

View in Genome Browser
Species Human (GRCh38)
Location 22:50732443-50732465
Sequence GAGGCTCTGGAAGGACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420633_1185420650 25 Left 1185420633 22:50732443-50732465 CCAGCCTGTCCTTCCAGAGCCTC No data
Right 1185420650 22:50732491-50732513 TGAATCCCTGCTGCTTGGGGAGG No data
1185420633_1185420643 2 Left 1185420633 22:50732443-50732465 CCAGCCTGTCCTTCCAGAGCCTC No data
Right 1185420643 22:50732468-50732490 CCAGCCTGAGCGGGGTTCCCTGG No data
1185420633_1185420638 -7 Left 1185420633 22:50732443-50732465 CCAGCCTGTCCTTCCAGAGCCTC No data
Right 1185420638 22:50732459-50732481 GAGCCTCACCCAGCCTGAGCGGG No data
1185420633_1185420639 -6 Left 1185420633 22:50732443-50732465 CCAGCCTGTCCTTCCAGAGCCTC No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data
1185420633_1185420648 21 Left 1185420633 22:50732443-50732465 CCAGCCTGTCCTTCCAGAGCCTC No data
Right 1185420648 22:50732487-50732509 CTGGTGAATCCCTGCTGCTTGGG No data
1185420633_1185420637 -8 Left 1185420633 22:50732443-50732465 CCAGCCTGTCCTTCCAGAGCCTC No data
Right 1185420637 22:50732458-50732480 AGAGCCTCACCCAGCCTGAGCGG No data
1185420633_1185420649 22 Left 1185420633 22:50732443-50732465 CCAGCCTGTCCTTCCAGAGCCTC No data
Right 1185420649 22:50732488-50732510 TGGTGAATCCCTGCTGCTTGGGG No data
1185420633_1185420647 20 Left 1185420633 22:50732443-50732465 CCAGCCTGTCCTTCCAGAGCCTC No data
Right 1185420647 22:50732486-50732508 CCTGGTGAATCCCTGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420633 Original CRISPR GAGGCTCTGGAAGGACAGGC TGG (reversed) Intergenic
No off target data available for this crispr