ID: 1185420637

View in Genome Browser
Species Human (GRCh38)
Location 22:50732458-50732480
Sequence AGAGCCTCACCCAGCCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420627_1185420637 22 Left 1185420627 22:50732413-50732435 CCATCCTGCACCCTGGGTCCAGC No data
Right 1185420637 22:50732458-50732480 AGAGCCTCACCCAGCCTGAGCGG No data
1185420628_1185420637 18 Left 1185420628 22:50732417-50732439 CCTGCACCCTGGGTCCAGCTGTT No data
Right 1185420637 22:50732458-50732480 AGAGCCTCACCCAGCCTGAGCGG No data
1185420632_1185420637 -7 Left 1185420632 22:50732442-50732464 CCCAGCCTGTCCTTCCAGAGCCT No data
Right 1185420637 22:50732458-50732480 AGAGCCTCACCCAGCCTGAGCGG No data
1185420629_1185420637 12 Left 1185420629 22:50732423-50732445 CCCTGGGTCCAGCTGTTTGCCCA No data
Right 1185420637 22:50732458-50732480 AGAGCCTCACCCAGCCTGAGCGG No data
1185420633_1185420637 -8 Left 1185420633 22:50732443-50732465 CCAGCCTGTCCTTCCAGAGCCTC No data
Right 1185420637 22:50732458-50732480 AGAGCCTCACCCAGCCTGAGCGG No data
1185420630_1185420637 11 Left 1185420630 22:50732424-50732446 CCTGGGTCCAGCTGTTTGCCCAG No data
Right 1185420637 22:50732458-50732480 AGAGCCTCACCCAGCCTGAGCGG No data
1185420631_1185420637 4 Left 1185420631 22:50732431-50732453 CCAGCTGTTTGCCCAGCCTGTCC No data
Right 1185420637 22:50732458-50732480 AGAGCCTCACCCAGCCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420637 Original CRISPR AGAGCCTCACCCAGCCTGAG CGG Intergenic
No off target data available for this crispr