ID: 1185420639

View in Genome Browser
Species Human (GRCh38)
Location 22:50732460-50732482
Sequence AGCCTCACCCAGCCTGAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420634_1185420639 -10 Left 1185420634 22:50732447-50732469 CCTGTCCTTCCAGAGCCTCACCC No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data
1185420627_1185420639 24 Left 1185420627 22:50732413-50732435 CCATCCTGCACCCTGGGTCCAGC No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data
1185420628_1185420639 20 Left 1185420628 22:50732417-50732439 CCTGCACCCTGGGTCCAGCTGTT No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data
1185420633_1185420639 -6 Left 1185420633 22:50732443-50732465 CCAGCCTGTCCTTCCAGAGCCTC No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data
1185420631_1185420639 6 Left 1185420631 22:50732431-50732453 CCAGCTGTTTGCCCAGCCTGTCC No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data
1185420632_1185420639 -5 Left 1185420632 22:50732442-50732464 CCCAGCCTGTCCTTCCAGAGCCT No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data
1185420629_1185420639 14 Left 1185420629 22:50732423-50732445 CCCTGGGTCCAGCTGTTTGCCCA No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data
1185420630_1185420639 13 Left 1185420630 22:50732424-50732446 CCTGGGTCCAGCTGTTTGCCCAG No data
Right 1185420639 22:50732460-50732482 AGCCTCACCCAGCCTGAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420639 Original CRISPR AGCCTCACCCAGCCTGAGCG GGG Intergenic
No off target data available for this crispr