ID: 1185420657

View in Genome Browser
Species Human (GRCh38)
Location 22:50732514-50732536
Sequence CTGCCTCCAAGGGGCCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185420657_1185420675 14 Left 1185420657 22:50732514-50732536 CCCCAAGGGCCCCTTGGAGGCAG No data
Right 1185420675 22:50732551-50732573 GCTTCTGAGGGCATCATAGGGGG No data
1185420657_1185420663 -9 Left 1185420657 22:50732514-50732536 CCCCAAGGGCCCCTTGGAGGCAG No data
Right 1185420663 22:50732528-50732550 TGGAGGCAGCGCCCCCACCTTGG No data
1185420657_1185420673 12 Left 1185420657 22:50732514-50732536 CCCCAAGGGCCCCTTGGAGGCAG No data
Right 1185420673 22:50732549-50732571 GGGCTTCTGAGGGCATCATAGGG No data
1185420657_1185420665 1 Left 1185420657 22:50732514-50732536 CCCCAAGGGCCCCTTGGAGGCAG No data
Right 1185420665 22:50732538-50732560 GCCCCCACCTTGGGCTTCTGAGG No data
1185420657_1185420667 2 Left 1185420657 22:50732514-50732536 CCCCAAGGGCCCCTTGGAGGCAG No data
Right 1185420667 22:50732539-50732561 CCCCCACCTTGGGCTTCTGAGGG No data
1185420657_1185420672 11 Left 1185420657 22:50732514-50732536 CCCCAAGGGCCCCTTGGAGGCAG No data
Right 1185420672 22:50732548-50732570 TGGGCTTCTGAGGGCATCATAGG No data
1185420657_1185420664 -8 Left 1185420657 22:50732514-50732536 CCCCAAGGGCCCCTTGGAGGCAG No data
Right 1185420664 22:50732529-50732551 GGAGGCAGCGCCCCCACCTTGGG No data
1185420657_1185420674 13 Left 1185420657 22:50732514-50732536 CCCCAAGGGCCCCTTGGAGGCAG No data
Right 1185420674 22:50732550-50732572 GGCTTCTGAGGGCATCATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185420657 Original CRISPR CTGCCTCCAAGGGGCCCTTG GGG (reversed) Intergenic
No off target data available for this crispr