ID: 1185422814

View in Genome Browser
Species Human (GRCh38)
Location 22:50744527-50744549
Sequence CCACTTGTGTTTACAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 118}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185422812_1185422814 -5 Left 1185422812 22:50744509-50744531 CCTCAAACTTTACTACAACCACT 0: 2
1: 0
2: 3
3: 20
4: 194
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118
1185422809_1185422814 -2 Left 1185422809 22:50744506-50744528 CCCCCTCAAACTTTACTACAACC 0: 2
1: 0
2: 1
3: 14
4: 157
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118
1185422808_1185422814 5 Left 1185422808 22:50744499-50744521 CCTGACACCCCCTCAAACTTTAC 0: 2
1: 1
2: 0
3: 5
4: 124
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118
1185422807_1185422814 6 Left 1185422807 22:50744498-50744520 CCCTGACACCCCCTCAAACTTTA 0: 2
1: 0
2: 0
3: 3
4: 146
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118
1185422804_1185422814 18 Left 1185422804 22:50744486-50744508 CCCAAATGAAGCCCCTGACACCC 0: 1
1: 1
2: 0
3: 16
4: 158
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118
1185422802_1185422814 29 Left 1185422802 22:50744475-50744497 CCTCCTCACATCCCAAATGAAGC 0: 1
1: 1
2: 1
3: 17
4: 198
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118
1185422805_1185422814 17 Left 1185422805 22:50744487-50744509 CCAAATGAAGCCCCTGACACCCC 0: 1
1: 1
2: 0
3: 7
4: 157
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118
1185422801_1185422814 30 Left 1185422801 22:50744474-50744496 CCCTCCTCACATCCCAAATGAAG 0: 1
1: 1
2: 1
3: 28
4: 279
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118
1185422806_1185422814 7 Left 1185422806 22:50744497-50744519 CCCCTGACACCCCCTCAAACTTT 0: 2
1: 0
2: 1
3: 24
4: 170
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118
1185422810_1185422814 -3 Left 1185422810 22:50744507-50744529 CCCCTCAAACTTTACTACAACCA 0: 2
1: 0
2: 0
3: 19
4: 168
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118
1185422811_1185422814 -4 Left 1185422811 22:50744508-50744530 CCCTCAAACTTTACTACAACCAC 0: 2
1: 0
2: 1
3: 14
4: 252
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118
1185422803_1185422814 26 Left 1185422803 22:50744478-50744500 CCTCACATCCCAAATGAAGCCCC 0: 1
1: 1
2: 1
3: 8
4: 207
Right 1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG 0: 1
1: 1
2: 2
3: 15
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185422814 Original CRISPR CCACTTGTGTTTACAGCAGC AGG Intronic
901042057 1:6370208-6370230 CCACTTCTACTTACAGCAGAAGG - Intronic
901967682 1:12881789-12881811 CCACTAGTGTTTACTGTAACAGG + Intronic
902181146 1:14689489-14689511 ACACCTGTGTTTATGGCAGCTGG + Intronic
904576440 1:31507922-31507944 CCACATGTGTTCTAAGCAGCAGG - Intergenic
907287903 1:53393684-53393706 ACATTTCTGTGTACAGCAGCTGG - Intergenic
908480366 1:64533444-64533466 CCATATGTATTTATAGCAGCTGG + Intronic
913029974 1:114892204-114892226 CCAGTTGTGTTTATAGGTGCTGG + Intronic
915142086 1:153774196-153774218 CCACTTTTGTCTAGAGCAGAAGG + Intergenic
917516725 1:175714650-175714672 CCACTTTTGTTTCCAGCTACAGG + Intronic
1062932795 10:1363759-1363781 CCACTTGTGCAAACTGCAGCTGG - Exonic
1066556045 10:36614237-36614259 CCTCTTCTGGTTACAGCAACTGG + Intergenic
1066589100 10:36973343-36973365 CCACTTTTATTTACAGAACCTGG - Intergenic
1070146781 10:73780078-73780100 CAACCTCTGTATACAGCAGCAGG - Intronic
1070340739 10:75495821-75495843 CCACCTGGGTTTGCAACAGCTGG - Intronic
1070700372 10:78597657-78597679 CCAGATGTGTTTAATGCAGCAGG - Intergenic
1073835646 10:107438014-107438036 CCCCTTGGGTTTCCAGCAGAGGG - Intergenic
1075224812 10:120618892-120618914 CCACCTGTATTTAAAGCAGTGGG + Intergenic
1076638982 10:131901222-131901244 CCCGTTGTGTTTGCAGGAGCCGG + Exonic
1078827265 11:14941091-14941113 TCACTTGTATTTTCAGCACCAGG - Intronic
1079390735 11:20019785-20019807 CTACTTGAGTTTTCAGCAGCAGG - Intronic
1079767028 11:24406592-24406614 CCACTAGAGGTTTCAGCAGCAGG + Intergenic
1081370200 11:42291100-42291122 GCACATGTCTTTATAGCAGCAGG + Intergenic
1083009392 11:59382115-59382137 GCATGTGTCTTTACAGCAGCAGG + Intergenic
1083341981 11:61964160-61964182 TCACCTGTGTGTACACCAGCAGG + Exonic
1084531008 11:69727721-69727743 ACACTTGTGTTTCCAGCTGTAGG - Intergenic
1085302092 11:75464722-75464744 CCACTTGTGTCTGCCCCAGCTGG + Intronic
1085885025 11:80511748-80511770 CTGCTTCTGCTTACAGCAGCAGG - Intergenic
1088898204 11:114093643-114093665 CCACTTCTGTGTCCAGCAGCTGG + Intronic
1091101686 11:132880513-132880535 CCAGTTTTGTTTTCAGCATCTGG - Intronic
1096096160 12:48937194-48937216 CCACTTTTGTTGATAGCAGATGG - Exonic
1097103242 12:56604240-56604262 CCACTTGTTTTTCCTGTAGCTGG + Exonic
1097949304 12:65408934-65408956 CCGCTTGTGATTCCAGCAGGGGG - Intronic
1098881700 12:75924098-75924120 CCACTTCTTTATACAGCTGCTGG - Intergenic
1104387798 12:128365979-128366001 CCAGCTGAGTTTACAGCAGTGGG - Intronic
1104844711 12:131840944-131840966 CCGCGTGTGTTTTCAGCCGCAGG - Intronic
1106092232 13:26606772-26606794 CCTCTCTTGTTTACTGCAGCTGG + Intronic
1107168966 13:37317213-37317235 ACACTTATGCTGACAGCAGCTGG + Intergenic
1107415318 13:40194530-40194552 ACACGTATGTTTTCAGCAGCCGG + Intergenic
1111134672 13:84025535-84025557 CTTTTTGTGTTAACAGCAGCAGG + Intergenic
1112357421 13:98685670-98685692 CCACTTGTTGTTAACGCAGCTGG - Intronic
1113948599 13:114058737-114058759 TCACCTGTGTCCACAGCAGCAGG - Intronic
1119798896 14:77425052-77425074 CCACTAGCTTTTCCAGCAGCGGG + Intergenic
1122258206 14:100495409-100495431 CCCCTTATGTTTCCAGCAGAAGG - Intronic
1124129668 15:26972395-26972417 CCAGTTGTGTTTACAGCAACAGG - Intronic
1126861703 15:52890636-52890658 CCAATTGTGTTTCCAGCACGGGG + Intergenic
1129297969 15:74610206-74610228 CCACTTCTGTCTGCAGCAGCAGG + Intronic
1131593837 15:93776420-93776442 CCATGTGTCTTTATAGCAGCAGG - Intergenic
1132492437 16:240165-240187 TCATTTGTGTGTATAGCAGCTGG + Intronic
1132869604 16:2109960-2109982 ACGCTTGTGTTGACGGCAGCTGG + Exonic
1133200384 16:4200579-4200601 AAACTTGTGTGTACAGCAGCAGG - Intronic
1134592215 16:15463751-15463773 GCAGTTGTGTCAACAGCAGCAGG - Intronic
1134717811 16:16365639-16365661 ACACTTGTGTTGACGGCAGCTGG - Intergenic
1134956939 16:18386520-18386542 ACGCTTGTGTTGACGGCAGCTGG + Intergenic
1137393625 16:48101556-48101578 CCTCGGGTGTTTACAGCAGCTGG + Intronic
1138450489 16:57091304-57091326 TCTCTTGTCTTTCCAGCAGCAGG - Intergenic
1142622180 17:1172181-1172203 CCACTTGTGGATGGAGCAGCGGG - Intronic
1143746131 17:8995573-8995595 CCACATAGGTTTACAGCTGCAGG + Intergenic
1147624107 17:41888212-41888234 CCACTTGTGTTTTCAGGAGATGG - Intronic
1150135678 17:62693675-62693697 CCACAGGTGTTTTCTGCAGCTGG + Intergenic
1151634061 17:75331945-75331967 CCACTTGCTTTCACAGCAGCTGG - Intronic
1152786659 17:82251608-82251630 CCCCTTGAGTGTGCAGCAGCAGG - Intronic
1152855560 17:82663278-82663300 CCACGTGTGCCTCCAGCAGCTGG - Intronic
1153715726 18:7846125-7846147 CCAGTAGTGTTTGCTGCAGCTGG + Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155849482 18:30752930-30752952 TCACTTGTGATGACAGCAGTAGG - Intergenic
1159595991 18:70383289-70383311 CCACCTGTGTGTGAAGCAGCAGG + Intergenic
1159946774 18:74449789-74449811 CCAAATGTGTTTAAAGCAGCTGG - Intronic
1160934280 19:1585773-1585795 CACCTTGGGGTTACAGCAGCAGG + Intronic
1164602971 19:29576006-29576028 CCACTTCTGGTGACAGCCGCTGG - Intergenic
925788008 2:7451928-7451950 GCACTTTTGTTTACTGTAGCTGG + Intergenic
928094382 2:28394637-28394659 CAACTTGTTTCTAAAGCAGCCGG + Intronic
929913241 2:46111757-46111779 ACACTAATATTTACAGCAGCAGG - Intronic
936577418 2:113668137-113668159 CCACTTGCGTTTACAGCAGCAGG - Intergenic
937288611 2:120768486-120768508 CCCCTTCTGTTCCCAGCAGCGGG - Intronic
937464036 2:122114280-122114302 CCACTTTTGCTTACAGCAGCAGG - Intergenic
938707946 2:133949913-133949935 CCACTTGAGTATCCAGCAACTGG - Intergenic
939269620 2:139921014-139921036 TCAGTTGTGTTTAAAGCAGTAGG + Intergenic
941774226 2:169374473-169374495 CCACCAGTGTTTACAGCACCAGG + Intergenic
942381557 2:175396762-175396784 CTACATGGGTTTTCAGCAGCAGG + Intergenic
944656423 2:201880682-201880704 TAACTTGTGTTTACAGGAGGTGG - Intronic
948020878 2:234732413-234732435 CCACATCTGCTTCCAGCAGCAGG + Intergenic
948947813 2:241230043-241230065 GCACTTGTGTTTCCAGAGGCAGG - Intronic
1172533435 20:35652134-35652156 CAACTTCTATTTTCAGCAGCTGG + Exonic
1174835357 20:53851825-53851847 CCTCTTGTATTTCCTGCAGCAGG + Intergenic
1179723979 21:43331525-43331547 ACAGCTGTGTTTACAGCATCTGG - Intergenic
1181665528 22:24393385-24393407 CCAGGTGTGTTTGCAGCTGCAGG + Intronic
1181935932 22:26438280-26438302 CCACTATGGTTAACAGCAGCTGG - Intronic
1185422814 22:50744527-50744549 CCACTTGTGTTTACAGCAGCAGG + Intronic
949617467 3:5769990-5770012 CCACTAGGGGTTAGAGCAGCAGG - Intergenic
951516032 3:23560533-23560555 GCACGTGTCTTTATAGCAGCAGG + Intronic
952982132 3:38745323-38745345 ACACTGGTGTTAACAGGAGCAGG - Intronic
954876700 3:53807080-53807102 CCACCTGTGTTCTCAGCTGCAGG + Intronic
956816712 3:72914690-72914712 GCACTTGTGGTGACAGTAGCTGG + Intronic
960961918 3:123077070-123077092 GGACTTGTATTTACAGCAGCAGG + Intronic
961409146 3:126705593-126705615 CCACCTGTGTCTACACCTGCAGG + Intronic
965136052 3:164769870-164769892 CCACTTGAGTTTAATGCAGATGG - Intergenic
969401965 4:6961683-6961705 CCACTTGTGCTTACAGAAGATGG + Intronic
969718486 4:8880011-8880033 CCACCTCTGTTTCCAGCACCCGG - Intergenic
974211675 4:58784607-58784629 ACACTTGTATTTCCAGCAACTGG - Intergenic
976303546 4:83537127-83537149 CCGCTTGTTTTTACAGCCCCAGG + Intronic
977860813 4:101957717-101957739 CCAGTTATGCTTACAGCATCAGG - Intronic
978237557 4:106477869-106477891 TCACTTGTGGAAACAGCAGCTGG - Intergenic
978613673 4:110571946-110571968 CCAGATGTGTTGATAGCAGCAGG - Intergenic
980461413 4:133119638-133119660 CCACTAATGATTACAACAGCAGG + Intergenic
980920961 4:139084734-139084756 CCACCTTTATTTACAGCTGCAGG - Intronic
981814090 4:148808519-148808541 CCACTTCTGGTTACACCAGAAGG + Intergenic
982582816 4:157200873-157200895 CAACTGGTGTTTACACCAGTTGG - Intergenic
984281309 4:177674001-177674023 CCAAATGTGCTTCCAGCAGCAGG - Intergenic
985552542 5:540989-541011 TCACGTGTGTTAACAGGAGCGGG - Intergenic
986297644 5:6452845-6452867 TCAGTTGTGTGTGCAGCAGCAGG + Intronic
991424546 5:66477327-66477349 TCATTTGTATTTACTGCAGCAGG - Intergenic
992515509 5:77488133-77488155 CCACTTGCATTTCCAGCTGCTGG - Intronic
993452387 5:88088303-88088325 TCAATTGTGTTTACAGCTGGAGG - Intergenic
1000683010 5:164210132-164210154 CCACTTGTCTTTACAGAGTCAGG + Intergenic
1000899662 5:166897219-166897241 CCAGTTTTGTTTGCAGAAGCAGG + Intergenic
1001458313 5:171885228-171885250 CTCCTTGTGTTTCCAGCAGCGGG - Intronic
1002813168 6:654005-654027 GCACATCTGTTTACAGCATCTGG + Intronic
1005965662 6:30724731-30724753 CTACATGTGTTTTCAGCACCTGG - Exonic
1008518163 6:52337843-52337865 ACATTTGTGTTTGCAGCAGTAGG - Intergenic
1008851917 6:56032743-56032765 CCTCTTGTGCTTCCAGCAGAGGG - Intergenic
1011250745 6:85369472-85369494 CCATGTGTCTTTATAGCAGCAGG + Intergenic
1021765563 7:23944470-23944492 GCACCTGTGTTTACAGTTGCTGG - Intergenic
1025726897 7:64072595-64072617 CTATTTGTGGTTACAGCAGTAGG - Intronic
1030345848 7:108432084-108432106 CCACTTGTGTTAGCAGTTGCTGG + Intronic
1032205206 7:129857800-129857822 CCCCTTGTGTTCTCAGCACCTGG - Intronic
1035007316 7:155675830-155675852 CCACTTATGTTCCTAGCAGCAGG + Intronic
1035710504 8:1709878-1709900 GCCCTTGTGTTTCCAGCAGGTGG + Intergenic
1038131931 8:24742003-24742025 CCACTTCTTTTTGCAGCAGTTGG - Intergenic
1039532836 8:38279154-38279176 GAGCTTGTGTTAACAGCAGCTGG - Intronic
1047793112 8:128225754-128225776 CCACTTATATTTTCAGTAGCAGG - Intergenic
1048469057 8:134691139-134691161 CCACCTGTGTTTACATCACTGGG + Intronic
1055431591 9:76249544-76249566 GCACTTGTGTTTACTGCTGCTGG - Intronic
1055802049 9:80048747-80048769 GCACTGGTATTTACAGAAGCTGG - Intergenic
1059284407 9:113160312-113160334 CCCCATGTGTTCACAGCAGCTGG + Intronic
1191055232 X:56233433-56233455 CCACTTGGGGTTTCAGCAGTGGG + Intronic
1198064798 X:133085445-133085467 TCACTTGTGTTTACATCAATGGG + Intronic
1201312775 Y:12612021-12612043 CCACGTGTGCTTACACCATCAGG + Intergenic