ID: 1185422845

View in Genome Browser
Species Human (GRCh38)
Location 22:50744699-50744721
Sequence TGTGATTCCCACGACCACAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185422845_1185422851 -9 Left 1185422845 22:50744699-50744721 CCTATGTGGTCGTGGGAATCACA 0: 1
1: 1
2: 1
3: 3
4: 80
Right 1185422851 22:50744713-50744735 GGAATCACAAGCTGGGGGGTAGG 0: 2
1: 0
2: 1
3: 15
4: 240
1185422845_1185422852 15 Left 1185422845 22:50744699-50744721 CCTATGTGGTCGTGGGAATCACA 0: 1
1: 1
2: 1
3: 3
4: 80
Right 1185422852 22:50744737-50744759 TGTGCCCGTGCCAAGCGCCCCGG 0: 2
1: 0
2: 0
3: 6
4: 89
1185422845_1185422856 26 Left 1185422845 22:50744699-50744721 CCTATGTGGTCGTGGGAATCACA 0: 1
1: 1
2: 1
3: 3
4: 80
Right 1185422856 22:50744748-50744770 CAAGCGCCCCGGAATCTACACGG 0: 2
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185422845 Original CRISPR TGTGATTCCCACGACCACAT AGG (reversed) Exonic
901700914 1:11044443-11044465 GGTGATTCCCACTGCCCCATAGG - Intronic
902073396 1:13762354-13762376 TGTGAGTGCCACCACCACACTGG + Intronic
906034461 1:42741663-42741685 TGTGGGTCCCAAGACCAAATGGG + Intergenic
908146895 1:61256026-61256048 TTGGCTTCCCTCGACCACATTGG + Intronic
918478578 1:184952481-184952503 TGGGATTCCCCGGGCCACATTGG + Intronic
1063086624 10:2823972-2823994 TGTGATTCCCACTAACATTTAGG - Intergenic
1065579594 10:27156941-27156963 TGGGATTCCCGCCACCACACCGG + Intronic
1071842680 10:89489190-89489212 TGTGATATTCACGACCAAATTGG - Intronic
1072168449 10:92837247-92837269 TGTGATTCATACGAGCTCATGGG + Intronic
1078014239 11:7599530-7599552 TGTGATGCCCAGCACCACCTGGG + Intronic
1081279160 11:41187225-41187247 TGTATTTCCCAAGACCACCTTGG + Intronic
1082981561 11:59128602-59128624 TGGAATTCCCATGACCACAAAGG - Intergenic
1099955009 12:89344977-89344999 TGTGAATTCCACAGCCACATGGG - Intergenic
1101588177 12:106103150-106103172 TCTGATTCCCAAGGCCACACAGG + Intronic
1107871598 13:44751436-44751458 TTGGATTCCCTGGACCACATTGG + Intergenic
1109098861 13:58152640-58152662 TGTAATTCCCTTGACAACATAGG - Intergenic
1110939079 13:81326927-81326949 TCTGATTCCCTTCACCACATTGG + Intergenic
1112345104 13:98582879-98582901 TGGGATTACAAGGACCACATGGG - Intergenic
1112955255 13:105050233-105050255 AGTGCTTCCCATGAGCACATTGG - Intergenic
1117875009 14:60243265-60243287 TTTGCTTCCCTCGGCCACATTGG - Intergenic
1121678982 14:95777011-95777033 GGTGCTTCCCTCGACCACCTGGG + Intergenic
1125764805 15:42127451-42127473 TGTGTTTCCCAAGACCACCCTGG + Intergenic
1126657217 15:50991470-50991492 AGTGGTTCCCATGACCACTTGGG + Intronic
1131709547 15:95038022-95038044 TGTGACTCCCAAAGCCACATTGG - Intergenic
1133759746 16:8789068-8789090 TGTGCTTCCCACGTGCACACTGG + Intronic
1138030653 16:53557051-53557073 TGGGCTTCCCTGGACCACATTGG + Intergenic
1138333963 16:56237604-56237626 TGTGCTTCCCAAAAACACATGGG - Intronic
1140045821 16:71440036-71440058 TGTGATACACACTACCACATGGG + Intergenic
1146880595 17:36439853-36439875 TGTGTATCCCACGACCACCCTGG - Intergenic
1149413234 17:56430880-56430902 TCTGATCCCCAAGACAACATTGG - Intronic
1153503823 18:5774740-5774762 TGTGATTCACATGGACACATGGG + Intergenic
1155460404 18:26074094-26074116 TGTGATACCAAAGACTACATTGG - Intronic
1156903330 18:42326550-42326572 TGTTATTCCCACGAGCAATTTGG + Intergenic
1163834100 19:19562894-19562916 TGTGCTTCCCAGGACCAGGTGGG + Intronic
1165306510 19:35005956-35005978 TGGGATTCCCTCCACCACCTGGG - Intronic
1165450397 19:35879010-35879032 TGTGATTCCCAAAGCCACACAGG + Intronic
925254822 2:2474460-2474482 TGTGAGTCCCAGAACCACAGAGG - Intergenic
928372523 2:30751172-30751194 TGTGACGCACACGACAACATTGG + Exonic
934818734 2:97353592-97353614 TGAGATGCCCTGGACCACATTGG + Intergenic
935497636 2:103801527-103801549 TGTGGTTGACACGACCACCTAGG - Intergenic
936577386 2:113667965-113667987 TGTGATTCCCACGACCACACAGG + Intergenic
938739139 2:134214380-134214402 TTGGCTTCCCTCGACCACATTGG + Intronic
946266771 2:218550705-218550727 TCAGATTCCTACTACCACATTGG - Intronic
948316061 2:237029286-237029308 TGTGAGTCCCTCGACAGCATAGG + Intergenic
1170825319 20:19789663-19789685 TGAGAGTCCTACGACCCCATGGG - Intergenic
1175313101 20:58025349-58025371 TGTCTTTCCCACGACCATACAGG - Intergenic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1179790365 21:43752786-43752808 TGGGATTCCCAAGACCTCACAGG + Intronic
1179793111 21:43766994-43767016 TGGGATTCCCAAGACCTCACAGG + Intergenic
1183166087 22:36148424-36148446 TTTGATCCTCATGACCACATGGG + Intronic
1185422845 22:50744699-50744721 TGTGATTCCCACGACCACATAGG - Exonic
953615690 3:44488798-44488820 AGTGATGCCCACGCCAACATGGG + Intergenic
953659503 3:44881520-44881542 TGTGATGCCCAGCACCACCTTGG - Intronic
955109717 3:55936404-55936426 TGTCTTTCCCATGAGCACATAGG - Intronic
956351449 3:68341444-68341466 TGTTATTCCCACGAGCAATTTGG + Intronic
959231631 3:103661640-103661662 TTTGATACCTACAACCACATTGG + Intergenic
959959970 3:112287179-112287201 TGTGGTTCCAATGACCACATTGG - Intronic
971756267 4:30712426-30712448 TGTGAGTCTCACAACCACAGAGG - Intergenic
972431299 4:38984970-38984992 TGTGATTCCCTCGACTATATGGG + Intronic
974242783 4:59272912-59272934 TATTATTTCCAAGACCACATGGG + Intergenic
975893646 4:79059763-79059785 TGAGATTCCCATGACCACATGGG + Intergenic
978432656 4:108650129-108650151 TATTATTACCACGACTACATCGG + Intergenic
980207501 4:129739922-129739944 TGTGAGTGCCTGGACCACATTGG - Intergenic
982693504 4:158573570-158573592 TGGGCTTCCCTGGACCACATTGG - Intronic
988728244 5:33944711-33944733 TGTGATCACCACGACGACAACGG + Exonic
990815641 5:59781908-59781930 TGTTATTCCCAACTCCACATAGG - Intronic
994858980 5:105163333-105163355 TGGGATTCCCTGGACAACATTGG - Intergenic
996154253 5:120078450-120078472 TGTGATTTTCATGACCACAGAGG + Intergenic
1005932805 6:30496483-30496505 TCTGGATCCCACTACCACATAGG + Intergenic
1008061068 6:46997389-46997411 TCTCATTCCCACAACCACAAGGG + Intergenic
1031486278 7:122329823-122329845 TCTGAATCACAAGACCACATAGG + Intronic
1034354939 7:150444366-150444388 TGTGGCACCCACCACCACATGGG + Intergenic
1035604858 8:923393-923415 TGTGATGCCCACGAGGGCATGGG + Intergenic
1042647772 8:71006403-71006425 TGGGCTTCCCTGGACCACATTGG - Intergenic
1044242765 8:89906211-89906233 TTTGCTTCCCTGGACCACATTGG + Intronic
1046794984 8:118361353-118361375 ACTGATTCCCACTACCTCATCGG + Intronic
1051954014 9:22667669-22667691 TGTGATTGTCACGACAGCATGGG + Intergenic
1055363347 9:75518938-75518960 TGTTCTTCCCATGTCCACATGGG - Intergenic
1055787182 9:79883702-79883724 TGTGATGCCCAGGAGCACCTGGG - Intergenic
1056224843 9:84484641-84484663 TGTGCTTTCCAGGACCTCATTGG - Intergenic
1058441793 9:105016039-105016061 TGTTATTCCCACAACTAAATTGG + Intergenic
1060561341 9:124546842-124546864 TGTGATCCTCACAACCACCTTGG + Intronic
1191225421 X:58037752-58037774 TGTGATTCCCTCTGCCACCTTGG + Intergenic
1195436064 X:104844516-104844538 TTTGCTTCCCTGGACCACATTGG + Intronic
1195498113 X:105561549-105561571 TGAGATTCCCACCAGCACAGAGG + Intronic
1201460751 Y:14221071-14221093 TGTTTTTCCCACGACTACACTGG + Intergenic