ID: 1185423374

View in Genome Browser
Species Human (GRCh38)
Location 22:50748218-50748240
Sequence CCCTTAGATGTCTAGGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185423374_1185423385 26 Left 1185423374 22:50748218-50748240 CCAGGGACCTAGACATCTAAGGG No data
Right 1185423385 22:50748267-50748289 TGTGCCCACTTAGACATCCGAGG No data
1185423374_1185423379 2 Left 1185423374 22:50748218-50748240 CCAGGGACCTAGACATCTAAGGG No data
Right 1185423379 22:50748243-50748265 GTGCCCACCTAGACATCCGAGGG No data
1185423374_1185423387 28 Left 1185423374 22:50748218-50748240 CCAGGGACCTAGACATCTAAGGG No data
Right 1185423387 22:50748269-50748291 TGCCCACTTAGACATCCGAGGGG No data
1185423374_1185423378 1 Left 1185423374 22:50748218-50748240 CCAGGGACCTAGACATCTAAGGG No data
Right 1185423378 22:50748242-50748264 TGTGCCCACCTAGACATCCGAGG No data
1185423374_1185423380 3 Left 1185423374 22:50748218-50748240 CCAGGGACCTAGACATCTAAGGG No data
Right 1185423380 22:50748244-50748266 TGCCCACCTAGACATCCGAGGGG No data
1185423374_1185423386 27 Left 1185423374 22:50748218-50748240 CCAGGGACCTAGACATCTAAGGG No data
Right 1185423386 22:50748268-50748290 GTGCCCACTTAGACATCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185423374 Original CRISPR CCCTTAGATGTCTAGGTCCC TGG (reversed) Intergenic
No off target data available for this crispr