ID: 1185426616

View in Genome Browser
Species Human (GRCh38)
Location 22:50775349-50775371
Sequence CCCAGAGAACCTTCTCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426616_1185426624 23 Left 1185426616 22:50775349-50775371 CCTGAGAGAGAAGGTTCTCTGGG No data
Right 1185426624 22:50775395-50775417 AGCGTGCGCCCCCTAGGGAAAGG No data
1185426616_1185426621 18 Left 1185426616 22:50775349-50775371 CCTGAGAGAGAAGGTTCTCTGGG No data
Right 1185426621 22:50775390-50775412 GTCCCAGCGTGCGCCCCCTAGGG No data
1185426616_1185426620 17 Left 1185426616 22:50775349-50775371 CCTGAGAGAGAAGGTTCTCTGGG No data
Right 1185426620 22:50775389-50775411 AGTCCCAGCGTGCGCCCCCTAGG No data
1185426616_1185426625 30 Left 1185426616 22:50775349-50775371 CCTGAGAGAGAAGGTTCTCTGGG No data
Right 1185426625 22:50775402-50775424 GCCCCCTAGGGAAAGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426616 Original CRISPR CCCAGAGAACCTTCTCTCTC AGG (reversed) Intronic