ID: 1185426618

View in Genome Browser
Species Human (GRCh38)
Location 22:50775373-50775395
Sequence TGGGACTGAGTAGATGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426618_1185426632 19 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426632 22:50775415-50775437 AGGCAGCAGGCAACAGTGGAGGG No data
1185426618_1185426620 -7 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426620 22:50775389-50775411 AGTCCCAGCGTGCGCCCCCTAGG No data
1185426618_1185426630 15 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426630 22:50775411-50775433 GGAAAGGCAGCAGGCAACAGTGG No data
1185426618_1185426633 22 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data
1185426618_1185426624 -1 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426624 22:50775395-50775417 AGCGTGCGCCCCCTAGGGAAAGG No data
1185426618_1185426635 29 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426635 22:50775425-50775447 CAACAGTGGAGGGAGGCCTTGGG No data
1185426618_1185426634 28 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426634 22:50775424-50775446 GCAACAGTGGAGGGAGGCCTTGG No data
1185426618_1185426621 -6 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426621 22:50775390-50775412 GTCCCAGCGTGCGCCCCCTAGGG No data
1185426618_1185426625 6 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426625 22:50775402-50775424 GCCCCCTAGGGAAAGGCAGCAGG No data
1185426618_1185426631 18 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426631 22:50775414-50775436 AAGGCAGCAGGCAACAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426618 Original CRISPR TGGGACTGAGTAGATGCTGC GGG (reversed) Intronic