ID: 1185426621

View in Genome Browser
Species Human (GRCh38)
Location 22:50775390-50775412
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426616_1185426621 18 Left 1185426616 22:50775349-50775371 CCTGAGAGAGAAGGTTCTCTGGG No data
Right 1185426621 22:50775390-50775412 GTCCCAGCGTGCGCCCCCTAGGG No data
1185426618_1185426621 -6 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426621 22:50775390-50775412 GTCCCAGCGTGCGCCCCCTAGGG No data
1185426619_1185426621 -7 Left 1185426619 22:50775374-50775396 CCGCAGCATCTACTCAGTCCCAG No data
Right 1185426621 22:50775390-50775412 GTCCCAGCGTGCGCCCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type