ID: 1185426622

View in Genome Browser
Species Human (GRCh38)
Location 22:50775392-50775414
Sequence TTCCCTAGGGGGCGCACGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426622_1185426634 9 Left 1185426622 22:50775392-50775414 CCCAGCGTGCGCCCCCTAGGGAA No data
Right 1185426634 22:50775424-50775446 GCAACAGTGGAGGGAGGCCTTGG No data
1185426622_1185426632 0 Left 1185426622 22:50775392-50775414 CCCAGCGTGCGCCCCCTAGGGAA No data
Right 1185426632 22:50775415-50775437 AGGCAGCAGGCAACAGTGGAGGG No data
1185426622_1185426638 30 Left 1185426622 22:50775392-50775414 CCCAGCGTGCGCCCCCTAGGGAA No data
Right 1185426638 22:50775445-50775467 GGGAGCTTGTCTGACAGGTTAGG No data
1185426622_1185426636 25 Left 1185426622 22:50775392-50775414 CCCAGCGTGCGCCCCCTAGGGAA No data
Right 1185426636 22:50775440-50775462 GCCTTGGGAGCTTGTCTGACAGG No data
1185426622_1185426633 3 Left 1185426622 22:50775392-50775414 CCCAGCGTGCGCCCCCTAGGGAA No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data
1185426622_1185426635 10 Left 1185426622 22:50775392-50775414 CCCAGCGTGCGCCCCCTAGGGAA No data
Right 1185426635 22:50775425-50775447 CAACAGTGGAGGGAGGCCTTGGG No data
1185426622_1185426630 -4 Left 1185426622 22:50775392-50775414 CCCAGCGTGCGCCCCCTAGGGAA No data
Right 1185426630 22:50775411-50775433 GGAAAGGCAGCAGGCAACAGTGG No data
1185426622_1185426631 -1 Left 1185426622 22:50775392-50775414 CCCAGCGTGCGCCCCCTAGGGAA No data
Right 1185426631 22:50775414-50775436 AAGGCAGCAGGCAACAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426622 Original CRISPR TTCCCTAGGGGGCGCACGCT GGG (reversed) Intronic