ID: 1185426623

View in Genome Browser
Species Human (GRCh38)
Location 22:50775393-50775415
Sequence TTTCCCTAGGGGGCGCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426623_1185426631 -2 Left 1185426623 22:50775393-50775415 CCAGCGTGCGCCCCCTAGGGAAA No data
Right 1185426631 22:50775414-50775436 AAGGCAGCAGGCAACAGTGGAGG No data
1185426623_1185426633 2 Left 1185426623 22:50775393-50775415 CCAGCGTGCGCCCCCTAGGGAAA No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data
1185426623_1185426634 8 Left 1185426623 22:50775393-50775415 CCAGCGTGCGCCCCCTAGGGAAA No data
Right 1185426634 22:50775424-50775446 GCAACAGTGGAGGGAGGCCTTGG No data
1185426623_1185426636 24 Left 1185426623 22:50775393-50775415 CCAGCGTGCGCCCCCTAGGGAAA No data
Right 1185426636 22:50775440-50775462 GCCTTGGGAGCTTGTCTGACAGG No data
1185426623_1185426630 -5 Left 1185426623 22:50775393-50775415 CCAGCGTGCGCCCCCTAGGGAAA No data
Right 1185426630 22:50775411-50775433 GGAAAGGCAGCAGGCAACAGTGG No data
1185426623_1185426638 29 Left 1185426623 22:50775393-50775415 CCAGCGTGCGCCCCCTAGGGAAA No data
Right 1185426638 22:50775445-50775467 GGGAGCTTGTCTGACAGGTTAGG No data
1185426623_1185426632 -1 Left 1185426623 22:50775393-50775415 CCAGCGTGCGCCCCCTAGGGAAA No data
Right 1185426632 22:50775415-50775437 AGGCAGCAGGCAACAGTGGAGGG No data
1185426623_1185426635 9 Left 1185426623 22:50775393-50775415 CCAGCGTGCGCCCCCTAGGGAAA No data
Right 1185426635 22:50775425-50775447 CAACAGTGGAGGGAGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426623 Original CRISPR TTTCCCTAGGGGGCGCACGC TGG (reversed) Intronic