ID: 1185426624

View in Genome Browser
Species Human (GRCh38)
Location 22:50775395-50775417
Sequence AGCGTGCGCCCCCTAGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426616_1185426624 23 Left 1185426616 22:50775349-50775371 CCTGAGAGAGAAGGTTCTCTGGG No data
Right 1185426624 22:50775395-50775417 AGCGTGCGCCCCCTAGGGAAAGG No data
1185426619_1185426624 -2 Left 1185426619 22:50775374-50775396 CCGCAGCATCTACTCAGTCCCAG No data
Right 1185426624 22:50775395-50775417 AGCGTGCGCCCCCTAGGGAAAGG No data
1185426618_1185426624 -1 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426624 22:50775395-50775417 AGCGTGCGCCCCCTAGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426624 Original CRISPR AGCGTGCGCCCCCTAGGGAA AGG Intronic