ID: 1185426626

View in Genome Browser
Species Human (GRCh38)
Location 22:50775403-50775425
Sequence GCCTGCTGCCTTTCCCTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426626_1185426634 -2 Left 1185426626 22:50775403-50775425 CCCCCTAGGGAAAGGCAGCAGGC No data
Right 1185426634 22:50775424-50775446 GCAACAGTGGAGGGAGGCCTTGG No data
1185426626_1185426638 19 Left 1185426626 22:50775403-50775425 CCCCCTAGGGAAAGGCAGCAGGC No data
Right 1185426638 22:50775445-50775467 GGGAGCTTGTCTGACAGGTTAGG No data
1185426626_1185426636 14 Left 1185426626 22:50775403-50775425 CCCCCTAGGGAAAGGCAGCAGGC No data
Right 1185426636 22:50775440-50775462 GCCTTGGGAGCTTGTCTGACAGG No data
1185426626_1185426639 30 Left 1185426626 22:50775403-50775425 CCCCCTAGGGAAAGGCAGCAGGC No data
Right 1185426639 22:50775456-50775478 TGACAGGTTAGGTCCATCAGAGG No data
1185426626_1185426633 -8 Left 1185426626 22:50775403-50775425 CCCCCTAGGGAAAGGCAGCAGGC No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data
1185426626_1185426635 -1 Left 1185426626 22:50775403-50775425 CCCCCTAGGGAAAGGCAGCAGGC No data
Right 1185426635 22:50775425-50775447 CAACAGTGGAGGGAGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426626 Original CRISPR GCCTGCTGCCTTTCCCTAGG GGG (reversed) Intronic