ID: 1185426627

View in Genome Browser
Species Human (GRCh38)
Location 22:50775404-50775426
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426627_1185426639 29 Left 1185426627 22:50775404-50775426 CCCCTAGGGAAAGGCAGCAGGCA No data
Right 1185426639 22:50775456-50775478 TGACAGGTTAGGTCCATCAGAGG No data
1185426627_1185426636 13 Left 1185426627 22:50775404-50775426 CCCCTAGGGAAAGGCAGCAGGCA No data
Right 1185426636 22:50775440-50775462 GCCTTGGGAGCTTGTCTGACAGG No data
1185426627_1185426635 -2 Left 1185426627 22:50775404-50775426 CCCCTAGGGAAAGGCAGCAGGCA No data
Right 1185426635 22:50775425-50775447 CAACAGTGGAGGGAGGCCTTGGG No data
1185426627_1185426638 18 Left 1185426627 22:50775404-50775426 CCCCTAGGGAAAGGCAGCAGGCA No data
Right 1185426638 22:50775445-50775467 GGGAGCTTGTCTGACAGGTTAGG No data
1185426627_1185426640 30 Left 1185426627 22:50775404-50775426 CCCCTAGGGAAAGGCAGCAGGCA No data
Right 1185426640 22:50775457-50775479 GACAGGTTAGGTCCATCAGAGGG No data
1185426627_1185426634 -3 Left 1185426627 22:50775404-50775426 CCCCTAGGGAAAGGCAGCAGGCA No data
Right 1185426634 22:50775424-50775446 GCAACAGTGGAGGGAGGCCTTGG No data
1185426627_1185426633 -9 Left 1185426627 22:50775404-50775426 CCCCTAGGGAAAGGCAGCAGGCA No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426627 Original CRISPR TGCCTGCTGCCTTTCCCTAG GGG (reversed) Intronic