ID: 1185426629

View in Genome Browser
Species Human (GRCh38)
Location 22:50775406-50775428
Sequence GTTGCCTGCTGCCTTTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426629_1185426639 27 Left 1185426629 22:50775406-50775428 CCTAGGGAAAGGCAGCAGGCAAC No data
Right 1185426639 22:50775456-50775478 TGACAGGTTAGGTCCATCAGAGG No data
1185426629_1185426638 16 Left 1185426629 22:50775406-50775428 CCTAGGGAAAGGCAGCAGGCAAC No data
Right 1185426638 22:50775445-50775467 GGGAGCTTGTCTGACAGGTTAGG No data
1185426629_1185426640 28 Left 1185426629 22:50775406-50775428 CCTAGGGAAAGGCAGCAGGCAAC No data
Right 1185426640 22:50775457-50775479 GACAGGTTAGGTCCATCAGAGGG No data
1185426629_1185426634 -5 Left 1185426629 22:50775406-50775428 CCTAGGGAAAGGCAGCAGGCAAC No data
Right 1185426634 22:50775424-50775446 GCAACAGTGGAGGGAGGCCTTGG No data
1185426629_1185426635 -4 Left 1185426629 22:50775406-50775428 CCTAGGGAAAGGCAGCAGGCAAC No data
Right 1185426635 22:50775425-50775447 CAACAGTGGAGGGAGGCCTTGGG No data
1185426629_1185426636 11 Left 1185426629 22:50775406-50775428 CCTAGGGAAAGGCAGCAGGCAAC No data
Right 1185426636 22:50775440-50775462 GCCTTGGGAGCTTGTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426629 Original CRISPR GTTGCCTGCTGCCTTTCCCT AGG (reversed) Intronic