ID: 1185426632

View in Genome Browser
Species Human (GRCh38)
Location 22:50775415-50775437
Sequence AGGCAGCAGGCAACAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426623_1185426632 -1 Left 1185426623 22:50775393-50775415 CCAGCGTGCGCCCCCTAGGGAAA No data
Right 1185426632 22:50775415-50775437 AGGCAGCAGGCAACAGTGGAGGG No data
1185426619_1185426632 18 Left 1185426619 22:50775374-50775396 CCGCAGCATCTACTCAGTCCCAG No data
Right 1185426632 22:50775415-50775437 AGGCAGCAGGCAACAGTGGAGGG No data
1185426618_1185426632 19 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426632 22:50775415-50775437 AGGCAGCAGGCAACAGTGGAGGG No data
1185426622_1185426632 0 Left 1185426622 22:50775392-50775414 CCCAGCGTGCGCCCCCTAGGGAA No data
Right 1185426632 22:50775415-50775437 AGGCAGCAGGCAACAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426632 Original CRISPR AGGCAGCAGGCAACAGTGGA GGG Intronic