ID: 1185426633

View in Genome Browser
Species Human (GRCh38)
Location 22:50775418-50775440
Sequence CAGCAGGCAACAGTGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426618_1185426633 22 Left 1185426618 22:50775373-50775395 CCCGCAGCATCTACTCAGTCCCA No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data
1185426619_1185426633 21 Left 1185426619 22:50775374-50775396 CCGCAGCATCTACTCAGTCCCAG No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data
1185426626_1185426633 -8 Left 1185426626 22:50775403-50775425 CCCCCTAGGGAAAGGCAGCAGGC No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data
1185426622_1185426633 3 Left 1185426622 22:50775392-50775414 CCCAGCGTGCGCCCCCTAGGGAA No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data
1185426628_1185426633 -10 Left 1185426628 22:50775405-50775427 CCCTAGGGAAAGGCAGCAGGCAA No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data
1185426627_1185426633 -9 Left 1185426627 22:50775404-50775426 CCCCTAGGGAAAGGCAGCAGGCA No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data
1185426623_1185426633 2 Left 1185426623 22:50775393-50775415 CCAGCGTGCGCCCCCTAGGGAAA No data
Right 1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426633 Original CRISPR CAGCAGGCAACAGTGGAGGG AGG Intronic