ID: 1185426636

View in Genome Browser
Species Human (GRCh38)
Location 22:50775440-50775462
Sequence GCCTTGGGAGCTTGTCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426627_1185426636 13 Left 1185426627 22:50775404-50775426 CCCCTAGGGAAAGGCAGCAGGCA No data
Right 1185426636 22:50775440-50775462 GCCTTGGGAGCTTGTCTGACAGG No data
1185426623_1185426636 24 Left 1185426623 22:50775393-50775415 CCAGCGTGCGCCCCCTAGGGAAA No data
Right 1185426636 22:50775440-50775462 GCCTTGGGAGCTTGTCTGACAGG No data
1185426626_1185426636 14 Left 1185426626 22:50775403-50775425 CCCCCTAGGGAAAGGCAGCAGGC No data
Right 1185426636 22:50775440-50775462 GCCTTGGGAGCTTGTCTGACAGG No data
1185426628_1185426636 12 Left 1185426628 22:50775405-50775427 CCCTAGGGAAAGGCAGCAGGCAA No data
Right 1185426636 22:50775440-50775462 GCCTTGGGAGCTTGTCTGACAGG No data
1185426629_1185426636 11 Left 1185426629 22:50775406-50775428 CCTAGGGAAAGGCAGCAGGCAAC No data
Right 1185426636 22:50775440-50775462 GCCTTGGGAGCTTGTCTGACAGG No data
1185426622_1185426636 25 Left 1185426622 22:50775392-50775414 CCCAGCGTGCGCCCCCTAGGGAA No data
Right 1185426636 22:50775440-50775462 GCCTTGGGAGCTTGTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426636 Original CRISPR GCCTTGGGAGCTTGTCTGAC AGG Intronic