ID: 1185426639

View in Genome Browser
Species Human (GRCh38)
Location 22:50775456-50775478
Sequence TGACAGGTTAGGTCCATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426626_1185426639 30 Left 1185426626 22:50775403-50775425 CCCCCTAGGGAAAGGCAGCAGGC No data
Right 1185426639 22:50775456-50775478 TGACAGGTTAGGTCCATCAGAGG No data
1185426628_1185426639 28 Left 1185426628 22:50775405-50775427 CCCTAGGGAAAGGCAGCAGGCAA No data
Right 1185426639 22:50775456-50775478 TGACAGGTTAGGTCCATCAGAGG No data
1185426629_1185426639 27 Left 1185426629 22:50775406-50775428 CCTAGGGAAAGGCAGCAGGCAAC No data
Right 1185426639 22:50775456-50775478 TGACAGGTTAGGTCCATCAGAGG No data
1185426627_1185426639 29 Left 1185426627 22:50775404-50775426 CCCCTAGGGAAAGGCAGCAGGCA No data
Right 1185426639 22:50775456-50775478 TGACAGGTTAGGTCCATCAGAGG No data
1185426637_1185426639 -8 Left 1185426637 22:50775441-50775463 CCTTGGGAGCTTGTCTGACAGGT No data
Right 1185426639 22:50775456-50775478 TGACAGGTTAGGTCCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426639 Original CRISPR TGACAGGTTAGGTCCATCAG AGG Intronic