ID: 1185426640

View in Genome Browser
Species Human (GRCh38)
Location 22:50775457-50775479
Sequence GACAGGTTAGGTCCATCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185426628_1185426640 29 Left 1185426628 22:50775405-50775427 CCCTAGGGAAAGGCAGCAGGCAA No data
Right 1185426640 22:50775457-50775479 GACAGGTTAGGTCCATCAGAGGG No data
1185426637_1185426640 -7 Left 1185426637 22:50775441-50775463 CCTTGGGAGCTTGTCTGACAGGT No data
Right 1185426640 22:50775457-50775479 GACAGGTTAGGTCCATCAGAGGG No data
1185426629_1185426640 28 Left 1185426629 22:50775406-50775428 CCTAGGGAAAGGCAGCAGGCAAC No data
Right 1185426640 22:50775457-50775479 GACAGGTTAGGTCCATCAGAGGG No data
1185426627_1185426640 30 Left 1185426627 22:50775404-50775426 CCCCTAGGGAAAGGCAGCAGGCA No data
Right 1185426640 22:50775457-50775479 GACAGGTTAGGTCCATCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185426640 Original CRISPR GACAGGTTAGGTCCATCAGA GGG Intronic