ID: 1185430382

View in Genome Browser
Species Human (GRCh38)
Location 22:50807256-50807278
Sequence CAAAGGCGGCGCGCCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185430382_1185430391 29 Left 1185430382 22:50807256-50807278 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 1185430391 22:50807308-50807330 ACACCCGGAGAGCATCGCCAGGG No data
1185430382_1185430390 28 Left 1185430382 22:50807256-50807278 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 1185430390 22:50807307-50807329 CACACCCGGAGAGCATCGCCAGG No data
1185430382_1185430389 14 Left 1185430382 22:50807256-50807278 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 1185430389 22:50807293-50807315 CGTTCTCTTTAGCACACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185430382 Original CRISPR CAAAGGCGGCGCGCCGGCGC AGG (reversed) Intergenic
No off target data available for this crispr