ID: 1185432085

View in Genome Browser
Species Human (GRCh38)
Location X:17335-17357
Sequence CCCATTCGGCCCCACCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185432073_1185432085 15 Left 1185432073 X:17297-17319 CCAGGCTGCCACTCCTTCCTTCC No data
Right 1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG No data
1185432070_1185432085 30 Left 1185432070 X:17282-17304 CCTGCTCCCTTGGGACCAGGCTG No data
Right 1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG No data
1185432072_1185432085 23 Left 1185432072 X:17289-17311 CCTTGGGACCAGGCTGCCACTCC No data
Right 1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG No data
1185432078_1185432085 -7 Left 1185432078 X:17319-17341 CCCTCACCTTGACCCTCCCATTC No data
Right 1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG No data
1185432076_1185432085 -2 Left 1185432076 X:17314-17336 CCTTCCCCTCACCTTGACCCTCC No data
Right 1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG No data
1185432074_1185432085 7 Left 1185432074 X:17305-17327 CCACTCCTTCCTTCCCCTCACCT No data
Right 1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG No data
1185432071_1185432085 24 Left 1185432071 X:17288-17310 CCCTTGGGACCAGGCTGCCACTC No data
Right 1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG No data
1185432079_1185432085 -8 Left 1185432079 X:17320-17342 CCTCACCTTGACCCTCCCATTCG No data
Right 1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG No data
1185432075_1185432085 2 Left 1185432075 X:17310-17332 CCTTCCTTCCCCTCACCTTGACC No data
Right 1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG No data
1185432077_1185432085 -6 Left 1185432077 X:17318-17340 CCCCTCACCTTGACCCTCCCATT No data
Right 1185432085 X:17335-17357 CCCATTCGGCCCCACCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185432085 Original CRISPR CCCATTCGGCCCCACCTGTC AGG Intergenic
No off target data available for this crispr