ID: 1185441401

View in Genome Browser
Species Human (GRCh38)
Location X:230049-230071
Sequence CCCATTCGGCCCCACCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185441389_1185441401 15 Left 1185441389 X:230011-230033 CCAGGCTGCCACTCCTTCCTTCC No data
Right 1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG No data
1185441386_1185441401 30 Left 1185441386 X:229996-230018 CCTGCTCCCTTGGGACCAGGCTG No data
Right 1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG No data
1185441387_1185441401 24 Left 1185441387 X:230002-230024 CCCTTGGGACCAGGCTGCCACTC No data
Right 1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG No data
1185441392_1185441401 -2 Left 1185441392 X:230028-230050 CCTTCCCCTCACCTTGACCCTCC No data
Right 1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG No data
1185441388_1185441401 23 Left 1185441388 X:230003-230025 CCTTGGGACCAGGCTGCCACTCC No data
Right 1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG No data
1185441395_1185441401 -8 Left 1185441395 X:230034-230056 CCTCACCTTGACCCTCCCATTCG No data
Right 1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG No data
1185441391_1185441401 2 Left 1185441391 X:230024-230046 CCTTCCTTCCCCTCACCTTGACC No data
Right 1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG No data
1185441393_1185441401 -6 Left 1185441393 X:230032-230054 CCCCTCACCTTGACCCTCCCATT No data
Right 1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG No data
1185441394_1185441401 -7 Left 1185441394 X:230033-230055 CCCTCACCTTGACCCTCCCATTC No data
Right 1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG No data
1185441390_1185441401 7 Left 1185441390 X:230019-230041 CCACTCCTTCCTTCCCCTCACCT No data
Right 1185441401 X:230049-230071 CCCATTCGGCCCCACCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185441401 Original CRISPR CCCATTCGGCCCCACCTGTC AGG Intergenic
No off target data available for this crispr