ID: 1185446362

View in Genome Browser
Species Human (GRCh38)
Location X:259901-259923
Sequence GGTGCACGTGGCTGTCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185446358_1185446362 -9 Left 1185446358 X:259887-259909 CCTGCCCTGGGGCAGGTGCACGT No data
Right 1185446362 X:259901-259923 GGTGCACGTGGCTGTCCCTGAGG No data
1185446351_1185446362 5 Left 1185446351 X:259873-259895 CCTGGACCATAAACCCTGCCCTG No data
Right 1185446362 X:259901-259923 GGTGCACGTGGCTGTCCCTGAGG No data
1185446348_1185446362 23 Left 1185446348 X:259855-259877 CCAATGTGACCTCAATAGCCTGG No data
Right 1185446362 X:259901-259923 GGTGCACGTGGCTGTCCCTGAGG No data
1185446350_1185446362 14 Left 1185446350 X:259864-259886 CCTCAATAGCCTGGACCATAAAC No data
Right 1185446362 X:259901-259923 GGTGCACGTGGCTGTCCCTGAGG No data
1185446357_1185446362 -8 Left 1185446357 X:259886-259908 CCCTGCCCTGGGGCAGGTGCACG No data
Right 1185446362 X:259901-259923 GGTGCACGTGGCTGTCCCTGAGG No data
1185446355_1185446362 -1 Left 1185446355 X:259879-259901 CCATAAACCCTGCCCTGGGGCAG No data
Right 1185446362 X:259901-259923 GGTGCACGTGGCTGTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185446362 Original CRISPR GGTGCACGTGGCTGTCCCTG AGG Intergenic